Incidental Mutation 'R7960:Slc8a3'
ID650079
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7960 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81216732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 627 (S627N)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]
Predicted Effect probably benign
Transcript: ENSMUST00000064594
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085238
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182208
AA Change: S627N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: S627N

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182366
SMART Domains Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

DomainStartEndE-ValueType
PDB:2LT9|A 1 52 2e-28 PDB
low complexity region 82 93 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik T C 7: 116,103,246 S82P possibly damaging Het
AA792892 A G 5: 94,383,880 M208V probably benign Het
Ablim2 A C 5: 35,857,149 E450A probably benign Het
Acacb G T 5: 114,230,861 M1713I probably benign Het
Acbd6 C A 1: 155,687,020 Q256K probably benign Het
Agbl2 A T 2: 90,791,631 N154I probably benign Het
Ahcyl2 A G 6: 29,870,627 N181D probably benign Het
Aldh18a1 A T 19: 40,557,820 D544E probably benign Het
Anapc1 A T 2: 128,674,593 L407Q probably damaging Het
Arhgap26 T A 18: 39,229,927 V34D Het
Brd3 A T 2: 27,452,933 S516T probably benign Het
Bsn A G 9: 108,115,548 S1002P probably damaging Het
C4b G T 17: 34,741,278 probably null Het
Camta1 T C 4: 151,148,533 T228A probably benign Het
Cct6b T C 11: 82,741,395 K256E possibly damaging Het
Cep85l T A 10: 53,296,307 Q552L probably benign Het
Col6a5 A G 9: 105,945,850 F103L unknown Het
Copb2 A G 9: 98,580,354 Q464R possibly damaging Het
Dlc1 G T 8: 36,937,835 H267N probably benign Het
Dnajb2 T C 1: 75,241,411 I184T Het
Dnajc9 C T 14: 20,388,696 E30K possibly damaging Het
Dock1 T C 7: 135,077,188 L1012P possibly damaging Het
Dtnbp1 T C 13: 44,953,174 K170R probably benign Het
F13b T A 1: 139,503,771 C26* probably null Het
Fam71a T A 1: 191,163,448 T333S probably benign Het
Ficd G T 5: 113,738,959 E398D probably benign Het
G6pc G A 11: 101,376,533 G270R probably damaging Het
Gm3604 T C 13: 62,369,773 Y257C probably damaging Het
Hmcn1 T A 1: 150,655,855 Y3221F probably damaging Het
Hs3st3b1 C T 11: 63,921,868 G7D possibly damaging Het
Htr3b A T 9: 48,945,552 S209T probably benign Het
Iglon5 T A 7: 43,476,902 E192D probably benign Het
Inpp5f A G 7: 128,693,914 probably null Het
Kif26b T A 1: 178,678,919 C187S probably damaging Het
Klhl11 A G 11: 100,463,979 S339P probably benign Het
Klk14 G A 7: 43,692,043 A40T probably damaging Het
Kmt2c G A 5: 25,315,196 T1972I probably benign Het
Lama2 T C 10: 26,993,098 T2784A probably benign Het
Loxhd1 T A 18: 77,385,050 F1088I probably damaging Het
Map2k2 G A 10: 81,119,134 R185Q probably benign Het
Mbd5 G A 2: 49,279,784 probably null Het
Mdc1 A T 17: 35,850,678 R828* probably null Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 A G 2: 85,648,073 S83P possibly damaging Het
Parp4 C A 14: 56,595,251 probably null Het
Pbk T A 14: 65,809,201 probably null Het
Phip A T 9: 82,893,348 D1060E probably benign Het
Pik3c2b T A 1: 133,103,849 L1509Q probably damaging Het
Pik3r5 T A 11: 68,495,970 F808L probably benign Het
Plcl1 T A 1: 55,697,284 S595T possibly damaging Het
Plxna2 AT A 1: 194,793,864 probably null Het
Pole A G 5: 110,289,861 K95R possibly damaging Het
Poteg A G 8: 27,456,860 T259A probably benign Het
Ptpn12 G T 5: 21,055,689 P20Q probably benign Het
Ptpn5 T A 7: 47,079,547 T440S possibly damaging Het
Ptpru T C 4: 131,788,509 R845G probably benign Het
Rasgrp2 G T 19: 6,414,809 V596L probably benign Het
Rcbtb2 T G 14: 73,161,944 V16G probably benign Het
Rel T C 11: 23,744,493 N289S probably damaging Het
Rpn1 T A 6: 88,102,086 Y504N probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Scaf8 G A 17: 3,171,122 V295M unknown Het
Slc25a48 T A 13: 56,463,598 Y173N probably damaging Het
Snx8 T A 5: 140,358,093 M123L probably benign Het
Sri A T 5: 8,064,586 Q180H probably benign Het
Sycp2 T A 2: 178,404,660 R4S probably null Het
Tcstv1 G A 13: 119,893,985 T37I possibly damaging Het
Tnnc2 A T 2: 164,777,784 D87E probably benign Het
Trim7 A T 11: 48,837,801 N92I probably damaging Het
Trpv6 C T 6: 41,627,678 D97N probably benign Het
Ttc30a1 A T 2: 75,980,844 D298E probably benign Het
Ttc37 T C 13: 76,112,199 C87R probably benign Het
Ulk4 A G 9: 121,272,956 Y19H probably damaging Het
Vmn2r69 C T 7: 85,406,765 V722I probably benign Het
Zan T C 5: 137,409,603 D3643G unknown Het
Zan G A 5: 137,464,892 T675I unknown Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6062:Slc8a3 UTSW 12 81314350 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGGACCTCTCTATGGATACCATG -3'
(R):5'- CCTCCATGCACTTGTGGAAC -3'

Sequencing Primer
(F):5'- CTCTCTATGGATACCATGTGACAGG -3'
(R):5'- CTTGTGGAACTAGGGCCAATTTGAAC -3'
Posted On2020-09-15