Incidental Mutation 'R7961:Sntg1'
ID650093
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Namesyntrophin, gamma 1
SynonymsSYN4, G1SYN
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location8361475-9299878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 8363570 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 486 (V486I)
Ref Sequence ENSEMBL: ENSMUSP00000141839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000191683]
Predicted Effect probably damaging
Transcript: ENSMUST00000115488
AA Change: V487I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: V487I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132064
AA Change: V486I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: V486I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140295
AA Change: V487I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: V487I

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140302
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191683
AA Change: V486I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: V486I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8595410 critical splice donor site probably null
IGL01536:Sntg1 APN 1 8583200 splice site probably null
IGL01558:Sntg1 APN 1 8463388 splice site probably benign
IGL01649:Sntg1 APN 1 8681969 splice site probably benign
IGL02230:Sntg1 APN 1 8681971 critical splice donor site probably null
IGL02252:Sntg1 APN 1 8414228 missense probably benign 0.00
IGL02804:Sntg1 APN 1 8803958 utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8445104 missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8463414 missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8463462 missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8679062 splice site probably benign
R0379:Sntg1 UTSW 1 8782824 missense probably damaging 1.00
R0551:Sntg1 UTSW 1 8554736 missense possibly damaging 0.73
R1081:Sntg1 UTSW 1 8445119 missense possibly damaging 0.92
R1645:Sntg1 UTSW 1 8803931 missense probably benign 0.06
R2089:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R3951:Sntg1 UTSW 1 8782901 splice site probably benign
R4152:Sntg1 UTSW 1 8583345 splice site probably null
R4153:Sntg1 UTSW 1 8583345 splice site probably null
R4154:Sntg1 UTSW 1 8583345 splice site probably null
R4847:Sntg1 UTSW 1 8595482 missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8363594 missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8782798 missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8363439 utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8595533 missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8624784 missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8414271 missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8463443 missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8414270 missense probably benign 0.00
R6075:Sntg1 UTSW 1 8679114 makesense probably null
R6266:Sntg1 UTSW 1 8554729 missense possibly damaging 0.56
R6313:Sntg1 UTSW 1 8445024 splice site probably null
R6345:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8363528 utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8445050 missense probably benign 0.16
R7112:Sntg1 UTSW 1 8448065 missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8682019 missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8448065 missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8445025 critical splice donor site probably null
R7892:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R7968:Sntg1 UTSW 1 8465536 nonsense probably null
R8009:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
X0026:Sntg1 UTSW 1 8414247 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- ACAGCATGGTCTCTTCAGGG -3'
(R):5'- ACATGTGGGTTATCCTCATTGC -3'

Sequencing Primer
(F):5'- CATGGTCTCTTCAGGGTGGAAG -3'
(R):5'- GTGGGTTATCCTCATTGCAATAAC -3'
Posted On2020-09-15