Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Dyrk3'

650097

Institutional Source

Beutler Lab

Gene Symbol

Dyrk3

Ensembl Gene

ENSMUSG00000016526

Gene Name

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.406) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

131127455-131138340 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 131136258 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000016670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016670] [ENSMUST00000189756]

Predicted Effect

probably null
Transcript: ENSMUST00000016670

SMART Domains

Protein: ENSMUSP00000016670
Gene: ENSMUSG00000016526

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC
S_TKc	208	521	2.45e-91	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000189756

SMART Domains

Protein: ENSMUSP00000140050
Gene: ENSMUSG00000016526

Domain	Start	End	E-Value	Type
PDB:4AZF\|A	101	152	3e-18	PDB

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the DYRK family of dual-specificity protein kinases that catalyze autophosphorylation on serine/threonine and tyrosine residues. The members of this family share structural similarity, however, differ in their substrate specificity, suggesting their involvement in different cellular functions. The encoded protein has been shown to autophosphorylate on tyrosine residue and catalyze phosphorylation of histones H3 and H2B in vitro. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased erythropoiesis in response to chemically-induced anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Dyrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00693:Dyrk3	APN	1	131136337	missense	possibly damaging	0.71
IGL00910:Dyrk3	APN	1	131136336	missense	possibly damaging	0.92
IGL02436:Dyrk3	APN	1	131128865	missense	probably benign	0.00
IGL03057:Dyrk3	APN	1	131129078	missense	probably benign	0.01
PIT4576001:Dyrk3	UTSW	1	131130181	missense	probably damaging	0.98
R0116:Dyrk3	UTSW	1	131129839	missense	probably damaging	1.00
R0361:Dyrk3	UTSW	1	131130032	missense	probably benign	0.00
R0457:Dyrk3	UTSW	1	131136357	missense	possibly damaging	0.94
R0529:Dyrk3	UTSW	1	131130121	missense	probably benign	0.00
R0724:Dyrk3	UTSW	1	131130140	missense	probably benign	0.00
R1116:Dyrk3	UTSW	1	131129182	missense	probably damaging	1.00
R2999:Dyrk3	UTSW	1	131129446	missense	probably damaging	1.00
R3423:Dyrk3	UTSW	1	131129482	missense	probably damaging	1.00
R4591:Dyrk3	UTSW	1	131130158	missense	probably damaging	1.00
R5358:Dyrk3	UTSW	1	131129695	missense	probably damaging	1.00
R5608:Dyrk3	UTSW	1	131128715	missense	probably benign
R6767:Dyrk3	UTSW	1	131129590	missense	probably damaging	0.99
R7072:Dyrk3	UTSW	1	131129728	missense	probably damaging	1.00
R7744:Dyrk3	UTSW	1	131129806	missense	probably damaging	1.00
R7775:Dyrk3	UTSW	1	131129627	missense	possibly damaging	0.84
R7909:Dyrk3	UTSW	1	131129587	missense	probably damaging	1.00
R8009:Dyrk3	UTSW	1	131136258	critical splice donor site	probably null
R8298:Dyrk3	UTSW	1	131129375	missense	probably damaging	1.00
Z1088:Dyrk3	UTSW	1	131129233	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTTTTCCCCAAGTCAGG -3'
(R):5'- GGGTGTTTTGAAAATGCAAGCTC -3'

Sequencing Primer
(F):5'- GTCTACACAGAGTTCCAGGTCAG -3'
(R):5'- AGCTCATTTTGTTTAGTTACTGACCG -3'

Posted On

2020-09-15