Incidental Mutation 'R7961:Olfr1298'
ID650100
Institutional Source Beutler Lab
Gene Symbol Olfr1298
Ensembl Gene ENSMUSG00000109487
Gene Nameolfactory receptor 1298
SynonymsGA_x6K02T2Q125-72697413-72696475, MOR248-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111644498-111649201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111645937 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 20 (S20F)
Ref Sequence ENSEMBL: ENSMUSP00000146343 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000119566
AA Change: S20F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208284
AA Change: S20F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Olfr1298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Olfr1298 APN 2 111645256 missense probably damaging 1.00
IGL01571:Olfr1298 APN 2 111645380 missense probably benign 0.00
IGL02605:Olfr1298 APN 2 111645505 missense probably benign 0.00
IGL02652:Olfr1298 APN 2 111645494 missense probably benign 0.16
IGL02669:Olfr1298 APN 2 111645891 nonsense probably null
R0197:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0701:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R0883:Olfr1298 UTSW 2 111645791 missense probably benign 0.00
R1563:Olfr1298 UTSW 2 111645682 missense probably damaging 1.00
R1567:Olfr1298 UTSW 2 111645926 missense possibly damaging 0.92
R1740:Olfr1298 UTSW 2 111645869 missense probably damaging 0.97
R2142:Olfr1298 UTSW 2 111645221 missense probably benign 0.04
R3949:Olfr1298 UTSW 2 111645526 missense possibly damaging 0.67
R4766:Olfr1298 UTSW 2 111645881 missense probably benign
R4924:Olfr1298 UTSW 2 111645776 missense possibly damaging 0.87
R7320:Olfr1298 UTSW 2 111645952 missense probably benign 0.03
R7695:Olfr1298 UTSW 2 111645625 missense probably damaging 1.00
R8549:Olfr1298 UTSW 2 111649167 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAAAGGAAATGGTCTTGTTTTCG -3'
(R):5'- CAGGTGAGTTCTAATATGGATGCC -3'

Sequencing Primer
(F):5'- AATCTATGATCATCTTAGGAGTGGTG -3'
(R):5'- TGGATGCCTAATTTTACAAACGAAG -3'
Posted On2020-09-15