Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Olfr1298'

650100

Institutional Source

Beutler Lab

Gene Symbol

Olfr1298

Ensembl Gene

ENSMUSG00000109487

Gene Name

olfactory receptor 1298

Synonyms

GA_x6K02T2Q125-72697413-72696475, MOR248-6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

111644498-111649201 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 111645937 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 20 (S20F)

Ref Sequence

ENSEMBL: ENSMUSP00000146343 (fasta)

Predicted Effect

probably damaging
Transcript: ENSMUST00000119566
AA Change: S20F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208284
AA Change: S20F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

Meta Mutation Damage Score

0.6329

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Olfr1298

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01393:Olfr1298	APN	2	111645256	missense	probably damaging	1.00
IGL01571:Olfr1298	APN	2	111645380	missense	probably benign	0.00
IGL02605:Olfr1298	APN	2	111645505	missense	probably benign	0.00
IGL02652:Olfr1298	APN	2	111645494	missense	probably benign	0.16
IGL02669:Olfr1298	APN	2	111645891	nonsense	probably null
R0197:Olfr1298	UTSW	2	111645791	missense	probably benign	0.00
R0701:Olfr1298	UTSW	2	111645791	missense	probably benign	0.00
R0883:Olfr1298	UTSW	2	111645791	missense	probably benign	0.00
R1563:Olfr1298	UTSW	2	111645682	missense	probably damaging	1.00
R1567:Olfr1298	UTSW	2	111645926	missense	possibly damaging	0.92
R1740:Olfr1298	UTSW	2	111645869	missense	probably damaging	0.97
R2142:Olfr1298	UTSW	2	111645221	missense	probably benign	0.04
R3949:Olfr1298	UTSW	2	111645526	missense	possibly damaging	0.67
R4766:Olfr1298	UTSW	2	111645881	missense	probably benign
R4924:Olfr1298	UTSW	2	111645776	missense	possibly damaging	0.87
R7320:Olfr1298	UTSW	2	111645952	missense	probably benign	0.03
R7695:Olfr1298	UTSW	2	111645625	missense	probably damaging	1.00
R8549:Olfr1298	UTSW	2	111649167	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAAAGGAAATGGTCTTGTTTTCG -3'
(R):5'- CAGGTGAGTTCTAATATGGATGCC -3'

Sequencing Primer
(F):5'- AATCTATGATCATCTTAGGAGTGGTG -3'
(R):5'- TGGATGCCTAATTTTACAAACGAAG -3'

Posted On

2020-09-15