Incidental Mutation 'R7961:Ciart'
ID650101
Institutional Source Beutler Lab
Gene Symbol Ciart
Ensembl Gene ENSMUSG00000038550
Gene Namecircadian associated repressor of transcription
SynonymsGm129, LOC229599
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95878503-95882251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95881317 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 70 (V70A)
Ref Sequence ENSEMBL: ENSMUSP00000049308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036360] [ENSMUST00000036418] [ENSMUST00000090476] [ENSMUST00000159739] [ENSMUST00000159863] [ENSMUST00000161866] [ENSMUST00000161867] [ENSMUST00000161994] [ENSMUST00000171519]
Predicted Effect probably benign
Transcript: ENSMUST00000036360
SMART Domains Protein: ENSMUSP00000046810
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 145 3.6e-64 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036418
AA Change: V70A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049308
Gene: ENSMUSG00000038550
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090476
SMART Domains Protein: ENSMUSP00000102749
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.8e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159739
AA Change: V70A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124943
Gene: ENSMUSG00000038550
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
Pfam:DUF4664 85 361 3.3e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159863
Predicted Effect probably benign
Transcript: ENSMUST00000161866
SMART Domains Protein: ENSMUSP00000135072
Gene: ENSMUSG00000038550

DomainStartEndE-ValueType
low complexity region 166 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161867
Predicted Effect possibly damaging
Transcript: ENSMUST00000161994
AA Change: V70A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124125
Gene: ENSMUSG00000038550
AA Change: V70A

DomainStartEndE-ValueType
low complexity region 2 33 N/A INTRINSIC
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171519
SMART Domains Protein: ENSMUSP00000127666
Gene: ENSMUSG00000038543

DomainStartEndE-ValueType
Pfam:DUF4634 1 146 1.5e-65 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype PHENOTYPE: Null mutants have slightly prolonged expression of circadian genes [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Ciart
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02943:Ciart APN 3 95879002 missense possibly damaging 0.55
PIT4453001:Ciart UTSW 3 95880476 missense probably damaging 1.00
R2044:Ciart UTSW 3 95878701 missense probably benign 0.00
R2079:Ciart UTSW 3 95879038 missense probably damaging 1.00
R5831:Ciart UTSW 3 95878902 missense probably damaging 0.96
R6251:Ciart UTSW 3 95881011 unclassified probably benign
R7024:Ciart UTSW 3 95879080 missense probably benign 0.30
R7801:Ciart UTSW 3 95881344 missense probably damaging 1.00
R7993:Ciart UTSW 3 95878894 nonsense probably null
R8009:Ciart UTSW 3 95881317 missense possibly damaging 0.58
R8098:Ciart UTSW 3 95881344 missense probably damaging 1.00
R8099:Ciart UTSW 3 95881344 missense probably damaging 1.00
R8100:Ciart UTSW 3 95881344 missense probably damaging 1.00
Z1177:Ciart UTSW 3 95879023 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATTAGGTGTTTGCCACTGC -3'
(R):5'- CTGCTCCTGGACCTATGGATTC -3'

Sequencing Primer
(F):5'- GCCACTGCACTATCTTTTCTG -3'
(R):5'- TGGATTCTCCATCTAGTGTTTCTTC -3'
Posted On2020-09-15