Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Abcb1b'

650104

Institutional Source

Beutler Lab

Gene Symbol

Abcb1b

Ensembl Gene

ENSMUSG00000028970

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 1B

Synonyms

Pgy-1, Abcb1, Mdr1, mdr, Pgy1, Mdr1b

MMRRC Submission

Accession Numbers

Genbank: NM_011075; MGI: 97568

Is this an essential gene?

Possibly non essential (E-score: 0.385) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8798147-8866315 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8828870 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 751 (N751K)

Ref Sequence

ENSEMBL: ENSMUSP00000009058 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009058] [ENSMUST00000199955]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009058
AA Change: N751K

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000009058
Gene: ENSMUSG00000028970
AA Change: N751K

Domain	Start	End	E-Value	Type
low complexity region	16	30	N/A	INTRINSIC
Pfam:ABC_membrane	50	342	1.4e-96	PFAM
AAA	418	610	4.32e-21	SMART
Pfam:ABC_membrane	709	984	1.9e-75	PFAM
AAA	1060	1248	4.13e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000199955

SMART Domains

Protein: ENSMUSP00000143766
Gene: ENSMUSG00000028970

Domain	Start	End	E-Value	Type
PDB:4M2T\|B	1	78	2e-26	PDB
Blast:AAA	33	78	2e-11	BLAST

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. This gene encodes a membrane glycoprotein which confers a multidrug-resistance phenotype. The protein encoded by the human gene is an ATP-dependent drug efflux pump for xenobiotic compounds which is responsible for decreased drug accumulation in multidrug-resistant cells and mediates the development of resistance to anticancer drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are hypersensitive to effects of drugs transported by phosphoglycoproteins. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(2) Gene trapped(8)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Abcb1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Abcb1b	APN	5	8827704	missense	probably benign	0.34
IGL00979:Abcb1b	APN	5	8825293	splice site	probably benign
IGL02157:Abcb1b	APN	5	8805487	splice site	probably benign
IGL02478:Abcb1b	APN	5	8806018	missense	probably damaging	0.98
IGL03174:Abcb1b	APN	5	8827752	missense	probably benign	0.03
IGL03189:Abcb1b	APN	5	8845814	missense	probably benign
IGL03195:Abcb1b	APN	5	8853607	missense	possibly damaging	0.83
PIT4283001:Abcb1b	UTSW	5	8813693	missense	probably damaging	1.00
R0049:Abcb1b	UTSW	5	8825661	missense	probably damaging	1.00
R0166:Abcb1b	UTSW	5	8853468	missense	probably damaging	1.00
R0254:Abcb1b	UTSW	5	8827409	missense	probably benign
R0319:Abcb1b	UTSW	5	8827428	missense	probably benign	0.01
R0358:Abcb1b	UTSW	5	8821423	missense	probably benign	0.16
R0365:Abcb1b	UTSW	5	8806009	missense	probably damaging	1.00
R0408:Abcb1b	UTSW	5	8853446	missense	probably damaging	0.98
R0521:Abcb1b	UTSW	5	8864238	missense	probably damaging	1.00
R0533:Abcb1b	UTSW	5	8864113	critical splice acceptor site	probably null
R0847:Abcb1b	UTSW	5	8845764	missense	probably damaging	0.99
R1037:Abcb1b	UTSW	5	8825657	missense	probably benign	0.03
R1432:Abcb1b	UTSW	5	8837771	missense	possibly damaging	0.69
R1437:Abcb1b	UTSW	5	8821436	missense	possibly damaging	0.90
R1520:Abcb1b	UTSW	5	8814768	missense	probably damaging	1.00
R1686:Abcb1b	UTSW	5	8798782	missense	probably damaging	0.97
R1700:Abcb1b	UTSW	5	8849537	missense	probably benign	0.44
R1973:Abcb1b	UTSW	5	8812746	missense	probably benign	0.01
R1993:Abcb1b	UTSW	5	8821322	missense	possibly damaging	0.61
R2157:Abcb1b	UTSW	5	8824791	missense	probably benign	0.37
R2207:Abcb1b	UTSW	5	8824803	missense	probably benign	0.23
R2968:Abcb1b	UTSW	5	8861485	missense	probably damaging	1.00
R3858:Abcb1b	UTSW	5	8813581	missense	probably benign	0.11
R4223:Abcb1b	UTSW	5	8813722	missense	probably damaging	0.97
R4379:Abcb1b	UTSW	5	8865875	missense	probably benign	0.00
R4674:Abcb1b	UTSW	5	8810615	missense	probably benign
R4964:Abcb1b	UTSW	5	8812671	missense	probably benign	0.00
R4964:Abcb1b	UTSW	5	8861602	missense	probably damaging	1.00
R5167:Abcb1b	UTSW	5	8812656	missense	probably damaging	0.98
R5216:Abcb1b	UTSW	5	8813705	missense	probably benign	0.04
R5328:Abcb1b	UTSW	5	8837694	missense	possibly damaging	0.69
R5391:Abcb1b	UTSW	5	8805481	missense	probably null	0.00
R5399:Abcb1b	UTSW	5	8827410	missense	probably benign
R6047:Abcb1b	UTSW	5	8806066	missense	probably damaging	1.00
R6157:Abcb1b	UTSW	5	8824245	missense	possibly damaging	0.81
R6293:Abcb1b	UTSW	5	8853493	missense	probably benign	0.05
R6493:Abcb1b	UTSW	5	8824698	missense	probably damaging	1.00
R6593:Abcb1b	UTSW	5	8853491	missense	probably benign
R6799:Abcb1b	UTSW	5	8812656	missense	probably damaging	0.98
R6944:Abcb1b	UTSW	5	8813693	missense	probably damaging	1.00
R7028:Abcb1b	UTSW	5	8805441	missense	probably damaging	0.99
R7227:Abcb1b	UTSW	5	8825593	missense	probably damaging	1.00
R7495:Abcb1b	UTSW	5	8865871	missense	probably damaging	1.00
R7573:Abcb1b	UTSW	5	8828866	missense	possibly damaging	0.80
R7681:Abcb1b	UTSW	5	8849619	missense	probably benign	0.00
R7827:Abcb1b	UTSW	5	8837747	missense	probably damaging	0.96
R7860:Abcb1b	UTSW	5	8832258	missense	probably benign	0.12
R8009:Abcb1b	UTSW	5	8828870	missense	possibly damaging	0.65
R8054:Abcb1b	UTSW	5	8824272	missense	probably benign
R8226:Abcb1b	UTSW	5	8821390	missense	probably damaging	1.00
R8283:Abcb1b	UTSW	5	8806086	missense	probably damaging	1.00
R8286:Abcb1b	UTSW	5	8864119	missense	probably damaging	1.00
R8362:Abcb1b	UTSW	5	8798758	missense	probably benign	0.00
R8387:Abcb1b	UTSW	5	8824698	missense	probably damaging	1.00
R8426:Abcb1b	UTSW	5	8861632	critical splice donor site	probably null
R8495:Abcb1b	UTSW	5	8865865	missense	probably damaging	0.99
X0025:Abcb1b	UTSW	5	8824515	missense	possibly damaging	0.91
X0061:Abcb1b	UTSW	5	8864269	splice site	probably null
Z1176:Abcb1b	UTSW	5	8827441	missense	probably benign
Z1177:Abcb1b	UTSW	5	8837596	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGAATGCAGATGCTTTGG -3'
(R):5'- CATCATCACGTCAAAGGCTGTAC -3'

Sequencing Primer
(F):5'- CAGAATGCAGATGCTTTGGAGGTC -3'
(R):5'- TCACGTCAAAGGCTGTACTGGAG -3'

Posted On

2020-09-15