Incidental Mutation 'R7961:Bckdha'
ID650111
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Namebranched chain ketoacid dehydrogenase E1, alpha polypeptide
SynonymsBCKAD E1[a]
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25629946-25658981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25631478 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 288 (R288W)
Ref Sequence ENSEMBL: ENSMUSP00000071292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329] [ENSMUST00000076034] [ENSMUST00000205281] [ENSMUST00000205808] [ENSMUST00000206940]
Predicted Effect probably damaging
Transcript: ENSMUST00000071329
AA Change: R288W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: R288W

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076034
SMART Domains Protein: ENSMUSP00000092277
Gene: ENSMUSG00000059479

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:Galactosyl_T 154 344 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205281
Predicted Effect probably damaging
Transcript: ENSMUST00000205808
AA Change: R38W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206940
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25633342 missense probably benign 0.00
IGL01322:Bckdha APN 7 25658707 missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25631109 missense probably damaging 1.00
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0194:Bckdha UTSW 7 25631450 missense probably damaging 1.00
R0615:Bckdha UTSW 7 25641785 missense probably benign 0.00
R1806:Bckdha UTSW 7 25631420 missense probably damaging 1.00
R2520:Bckdha UTSW 7 25641699 missense probably benign 0.18
R3847:Bckdha UTSW 7 25631652 missense probably damaging 1.00
R3975:Bckdha UTSW 7 25631433 missense probably damaging 1.00
R4630:Bckdha UTSW 7 25631459 missense probably damaging 1.00
R5655:Bckdha UTSW 7 25630364 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R8202:Bckdha UTSW 7 25630313 missense probably damaging 1.00
R8344:Bckdha UTSW 7 25631447 missense probably damaging 1.00
Z1176:Bckdha UTSW 7 25631143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCAGACCTGTGAGCTG -3'
(R):5'- TTCTTCTGCCGGAACAATGG -3'

Sequencing Primer
(F):5'- CTGTGAGCTGCAGGGGTG -3'
(R):5'- AACCTCTGAGCAGTACCGTG -3'
Posted On2020-09-15