Incidental Mutation 'R7961:Zfp60'
ID650112
Institutional Source Beutler Lab
Gene Symbol Zfp60
Ensembl Gene ENSMUSG00000037640
Gene Namezinc finger protein 60
Synonyms6330516O17Rik, Mfg-3, Mfg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7961 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location27731389-27753702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27748456 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 183 (G183D)
Ref Sequence ENSEMBL: ENSMUSP00000036627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042641] [ENSMUST00000108336] [ENSMUST00000130997] [ENSMUST00000136373] [ENSMUST00000167955]
Predicted Effect probably benign
Transcript: ENSMUST00000042641
AA Change: G183D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000036627
Gene: ENSMUSG00000037640
AA Change: G183D

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108336
AA Change: G183D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103973
Gene: ENSMUSG00000037640
AA Change: G183D

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130997
SMART Domains Protein: ENSMUSP00000118469
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136373
SMART Domains Protein: ENSMUSP00000117049
Gene: ENSMUSG00000037640

DomainStartEndE-ValueType
KRAB 14 55 3.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167955
AA Change: G183D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132607
Gene: ENSMUSG00000037640
AA Change: G183D

DomainStartEndE-ValueType
KRAB 14 75 8.48e-36 SMART
ZnF_C2H2 173 195 2.67e-1 SMART
ZnF_C2H2 201 223 2.09e-3 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 2.24e-3 SMART
ZnF_C2H2 285 307 2.65e-5 SMART
ZnF_C2H2 313 335 5.5e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2H2 369 391 6.32e-3 SMART
ZnF_C2H2 397 419 5.14e-3 SMART
ZnF_C2H2 425 447 7.9e-4 SMART
ZnF_C2H2 453 475 1.67e-2 SMART
ZnF_C2H2 481 503 4.4e-2 SMART
ZnF_C2H2 509 531 4.24e-4 SMART
ZnF_C2H2 537 559 5.21e-4 SMART
ZnF_C2H2 565 587 5.14e-3 SMART
ZnF_C2H2 593 615 3.89e-3 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 6.67e-2 SMART
ZnF_C2H2 677 699 8.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Other mutations in Zfp60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Zfp60 APN 7 27748334 nonsense probably null
PIT4494001:Zfp60 UTSW 7 27748701 missense probably damaging 1.00
R1281:Zfp60 UTSW 7 27738427 missense probably damaging 1.00
R1643:Zfp60 UTSW 7 27736975 missense probably damaging 0.98
R1883:Zfp60 UTSW 7 27750010 missense probably benign 0.00
R1930:Zfp60 UTSW 7 27736957 start codon destroyed probably null 1.00
R3623:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3624:Zfp60 UTSW 7 27749328 missense probably benign 0.01
R3875:Zfp60 UTSW 7 27749581 missense probably damaging 1.00
R5296:Zfp60 UTSW 7 27738530 intron probably benign
R5491:Zfp60 UTSW 7 27748515 splice site probably null
R5724:Zfp60 UTSW 7 27748333 missense probably benign
R6134:Zfp60 UTSW 7 27749898 missense probably benign 0.01
R6312:Zfp60 UTSW 7 27748776 missense probably damaging 0.99
R6477:Zfp60 UTSW 7 27749803 missense probably benign 0.00
R6649:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R6653:Zfp60 UTSW 7 27748726 missense probably benign 0.00
R7041:Zfp60 UTSW 7 27749026 missense probably benign 0.05
R7166:Zfp60 UTSW 7 27749512 missense possibly damaging 0.82
R7185:Zfp60 UTSW 7 27738405 missense probably damaging 1.00
R7334:Zfp60 UTSW 7 27749019 missense probably damaging 1.00
R7560:Zfp60 UTSW 7 27749136 missense probably damaging 0.99
R7560:Zfp60 UTSW 7 27749271 missense probably damaging 1.00
R7561:Zfp60 UTSW 7 27748530 missense probably damaging 1.00
R7673:Zfp60 UTSW 7 27748315 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTAGTAATGGCCCTGGCTATAG -3'
(R):5'- TGAAGGACTTCCCACACTCC -3'

Sequencing Primer
(F):5'- GCCCTGGCTATAGTGTAATCAAG -3'
(R):5'- ATATTTTTATGGTACTGAAGCAGGG -3'
Posted On2020-09-15