Incidental Mutation 'R7961:Ubqln3'
ID 650115
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 046005-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R7961 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103791797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 98 (I98L)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: I98L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I98L

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,878,870 (GRCm39) N751K possibly damaging Het
Bckdha G A 7: 25,330,903 (GRCm39) R288W probably damaging Het
Ccng1 G A 11: 40,642,096 (GRCm39) H229Y probably benign Het
Cenpn C A 8: 117,663,976 (GRCm39) T256N probably benign Het
Ciart A G 3: 95,788,629 (GRCm39) V70A possibly damaging Het
Clcc1 A G 3: 108,568,774 (GRCm39) N36S probably damaging Het
Cntnap1 G A 11: 101,069,121 (GRCm39) A192T probably benign Het
Dmrt1 T A 19: 25,523,245 (GRCm39) S199T possibly damaging Het
Dmrt3 T C 19: 25,588,272 (GRCm39) V37A possibly damaging Het
Dock1 T A 7: 134,346,786 (GRCm39) D239E possibly damaging Het
Dyrk3 A G 1: 131,063,995 (GRCm39) probably null Het
Engase A G 11: 118,377,686 (GRCm39) D571G possibly damaging Het
Gm45871 C T 18: 90,609,883 (GRCm39) H374Y probably damaging Het
Icam5 T C 9: 20,950,051 (GRCm39) V870A possibly damaging Het
Idh2 T C 7: 79,748,001 (GRCm39) H233R probably benign Het
Kcna5 A G 6: 126,510,517 (GRCm39) L537P probably benign Het
Krt71 T C 15: 101,643,877 (GRCm39) I454V probably damaging Het
Krtap5-4 C T 7: 141,857,671 (GRCm39) Q114* probably null Het
Loxl3 T C 6: 83,027,790 (GRCm39) F734S possibly damaging Het
Lpcat1 C T 13: 73,659,498 (GRCm39) T420I probably damaging Het
Mia2 T A 12: 59,206,425 (GRCm39) probably null Het
Neurod4 A T 10: 130,106,356 (GRCm39) V306D possibly damaging Het
Nkiras2 A T 11: 100,510,628 (GRCm39) probably benign Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Ntrk3 T A 7: 78,103,076 (GRCm39) D408V probably benign Het
Nubpl T A 12: 52,228,080 (GRCm39) L168* probably null Het
Odf1 A G 15: 38,226,840 (GRCm39) I247V unknown Het
Or4c35 A G 2: 89,808,131 (GRCm39) Q3R probably benign Het
Or4k48 G A 2: 111,476,282 (GRCm39) S20F probably damaging Het
Or5d41 C A 2: 88,055,033 (GRCm39) M114I possibly damaging Het
Pcsk1 T C 13: 75,274,958 (GRCm39) S516P probably benign Het
Pikfyve A G 1: 65,294,293 (GRCm39) D1411G probably damaging Het
Polm T C 11: 5,780,155 (GRCm39) D294G possibly damaging Het
Ppcs A T 4: 119,276,262 (GRCm39) S281T probably benign Het
Pramel34 T C 5: 93,784,543 (GRCm39) D307G probably damaging Het
Pspc1 G A 14: 57,009,304 (GRCm39) Q177* probably null Het
Rbm33 G A 5: 28,599,606 (GRCm39) G185R Het
Satb2 A G 1: 56,910,917 (GRCm39) S243P probably benign Het
Serinc5 T C 13: 92,797,699 (GRCm39) probably null Het
Sgsm1 T C 5: 113,430,510 (GRCm39) T292A probably damaging Het
Smad3 G A 9: 63,557,564 (GRCm39) R420C possibly damaging Het
Sntg1 C T 1: 8,433,794 (GRCm39) V486I probably damaging Het
Tep1 A G 14: 51,061,687 (GRCm39) S2610P possibly damaging Het
Tmem200a A G 10: 25,869,904 (GRCm39) S122P probably damaging Het
Tnks2 T A 19: 36,829,901 (GRCm39) M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,316,224 (GRCm39) Q28P probably damaging Het
Trpm5 T C 7: 142,634,106 (GRCm39) E700G probably benign Het
Usp25 A G 16: 76,856,150 (GRCm39) I248V probably damaging Het
Vmn1r28 T C 6: 58,242,178 (GRCm39) V7A probably benign Het
Zfp60 G A 7: 27,447,881 (GRCm39) G183D probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5724:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAACGAGCTGAGCCACAAG -3'
(R):5'- TGTAGACACATGCACCATCC -3'

Sequencing Primer
(F):5'- ACTGAGATGTGCTGCCAC -3'
(R):5'- CCATCCGGCAGCTAAAGG -3'
Posted On 2020-09-15