Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Trpm5'

650118

Institutional Source

Beutler Lab

Gene Symbol

Trpm5

Ensembl Gene

ENSMUSG00000009246

Gene Name

transient receptor potential cation channel, subfamily M, member 5

Synonyms

9430099A16Rik, Mtr1, Ltrpc5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143069153-143094642 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143080369 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 700 (E700G)

Ref Sequence

ENSEMBL: ENSMUSP00000009390 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009390] [ENSMUST00000150867]

Predicted Effect

probably benign
Transcript: ENSMUST00000009390
AA Change: E700G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000009390
Gene: ENSMUSG00000009246
AA Change: E700G

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
Pfam:Ion_trans	736	989	1.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150867
AA Change: E700G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000114302
Gene: ENSMUSG00000009246
AA Change: E700G

Domain	Start	End	E-Value	Type
Blast:ANK	382	411	2e-6	BLAST
transmembrane domain	644	666	N/A	INTRINSIC
transmembrane domain	731	753	N/A	INTRINSIC
transmembrane domain	811	833	N/A	INTRINSIC
transmembrane domain	872	894	N/A	INTRINSIC
transmembrane domain	952	974	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential (TRP) protein family, which is a diverse group of proteins with structural features typical of ion channels. This protein plays an important role in taste transduction, and has characteristics of a calcium-activated, non-selective cation channel that carries Na+, K+, and Cs+ ions equally well, but not Ca(2+) ions. It is activated by lower concentrations of intracellular Ca(2+), and inhibited by higher concentrations. It is also a highly temperature-sensitive, heat activated channel showing a steep increase of inward currents at temperatures between 15 and 35 degrees Celsius. This gene is located within the Beckwith-Wiedemann syndrome critical region-1 on chromosome 11p15.5, and has been shown to be imprinted, with exclusive expression from the paternal allele. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal taste perception, responding to sour and salty stimuli but not to sweet, or bitter stimuli. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Trpm5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Trpm5	APN	7	143082991	missense	probably benign	0.03
IGL00717:Trpm5	APN	7	143073990	missense	probably damaging	1.00
IGL01138:Trpm5	APN	7	143074569	missense	probably benign
IGL01590:Trpm5	APN	7	143082734	missense	probably damaging	0.99
IGL01603:Trpm5	APN	7	143075601	missense	probably benign	0.04
IGL01685:Trpm5	APN	7	143082354	missense	probably benign	0.05
IGL01878:Trpm5	APN	7	143074497	missense	probably damaging	1.00
IGL02533:Trpm5	APN	7	143089545	missense	probably benign	0.01
IGL02572:Trpm5	APN	7	143087876	splice site	probably benign
IGL02750:Trpm5	APN	7	143074484	missense	possibly damaging	0.89
IGL02862:Trpm5	APN	7	143082525	missense	probably damaging	1.00
R0032:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0238:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0239:Trpm5	UTSW	7	143082958	missense	probably damaging	1.00
R0334:Trpm5	UTSW	7	143086876	missense	probably benign	0.06
R0799:Trpm5	UTSW	7	143078351	missense	probably damaging	0.99
R1187:Trpm5	UTSW	7	143074469	missense	probably damaging	0.96
R1373:Trpm5	UTSW	7	143086842	splice site	probably benign
R1521:Trpm5	UTSW	7	143082889	missense	probably benign	0.00
R1603:Trpm5	UTSW	7	143085209	missense	probably benign	0.00
R1606:Trpm5	UTSW	7	143085171	nonsense	probably null
R2009:Trpm5	UTSW	7	143087738	missense	possibly damaging	0.58
R2437:Trpm5	UTSW	7	143082561	missense	probably benign	0.03
R2508:Trpm5	UTSW	7	143088919	missense	possibly damaging	0.80
R2516:Trpm5	UTSW	7	143074517	missense	probably damaging	1.00
R2985:Trpm5	UTSW	7	143082938	missense	probably damaging	0.99
R3036:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3037:Trpm5	UTSW	7	143085463	missense	probably benign	0.00
R3688:Trpm5	UTSW	7	143078456	missense	probably damaging	0.98
R4156:Trpm5	UTSW	7	143089055	missense	probably benign	0.04
R4734:Trpm5	UTSW	7	143082785	missense	probably benign	0.04
R4811:Trpm5	UTSW	7	143080219	missense	probably damaging	1.00
R4814:Trpm5	UTSW	7	143082636	missense	possibly damaging	0.50
R4847:Trpm5	UTSW	7	143087763	missense	possibly damaging	0.89
R5055:Trpm5	UTSW	7	143072784	missense	probably benign	0.00
R5256:Trpm5	UTSW	7	143082303	missense	probably damaging	1.00
R5413:Trpm5	UTSW	7	143080968	missense	probably damaging	1.00
R5668:Trpm5	UTSW	7	143073229	missense	probably benign	0.39
R6133:Trpm5	UTSW	7	143088951	missense	probably damaging	0.98
R6242:Trpm5	UTSW	7	143073182	missense	probably benign
R6564:Trpm5	UTSW	7	143072770	missense	probably damaging	1.00
R6702:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6703:Trpm5	UTSW	7	143069318	unclassified	probably benign
R6829:Trpm5	UTSW	7	143069429	unclassified	probably benign
R6940:Trpm5	UTSW	7	143084810	nonsense	probably null
R7337:Trpm5	UTSW	7	143089019	missense	probably benign	0.01
R7513:Trpm5	UTSW	7	143081835	missense	possibly damaging	0.84
R7560:Trpm5	UTSW	7	143080986	missense	probably damaging	1.00
R7801:Trpm5	UTSW	7	143085241	missense	probably damaging	1.00
R8009:Trpm5	UTSW	7	143080369	missense	probably benign	0.00
R8189:Trpm5	UTSW	7	143081838	missense	probably benign	0.32
R8441:Trpm5	UTSW	7	143072434	missense	possibly damaging	0.75
R8507:Trpm5	UTSW	7	143078313	missense	probably damaging	1.00
X0022:Trpm5	UTSW	7	143083042	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCCAGCACCAGTGTGAACAC -3'
(R):5'- TGGCCAGTAAGGAGTAGCTG -3'

Sequencing Primer
(F):5'- TAACCTCGGATCCAGACGG -3'
(R):5'- CCTGGAAAGATAGAGCACAGAC -3'

Posted On

2020-09-15