Incidental Mutation 'R7961:Cenpn'
ID650119
Institutional Source Beutler Lab
Gene Symbol Cenpn
Ensembl Gene ENSMUSG00000031756
Gene Namecentromere protein N
Synonyms2610510J17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location116921730-116941507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 116937237 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 256 (T256N)
Ref Sequence ENSEMBL: ENSMUSP00000034205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034205] [ENSMUST00000212263] [ENSMUST00000212775]
Predicted Effect probably benign
Transcript: ENSMUST00000034205
AA Change: T256N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034205
Gene: ENSMUSG00000031756
AA Change: T256N

DomainStartEndE-ValueType
Pfam:CENP-N 3 337 3.4e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212263
AA Change: T169N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000212775
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Cenpn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Cenpn APN 8 116928587 splice site probably null
IGL02084:Cenpn APN 8 116940895 missense probably damaging 1.00
R0791:Cenpn UTSW 8 116940820 splice site probably benign
R0843:Cenpn UTSW 8 116933306 missense probably benign 0.09
R1166:Cenpn UTSW 8 116926207 missense probably damaging 1.00
R1650:Cenpn UTSW 8 116934759 missense probably damaging 1.00
R2132:Cenpn UTSW 8 116934797 critical splice donor site probably null
R4512:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4513:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4514:Cenpn UTSW 8 116933396 missense probably damaging 1.00
R4865:Cenpn UTSW 8 116934773 missense probably damaging 1.00
R5969:Cenpn UTSW 8 116940537 missense probably damaging 1.00
R6518:Cenpn UTSW 8 116937165 missense possibly damaging 0.88
R6795:Cenpn UTSW 8 116926148 missense probably benign 0.02
R7143:Cenpn UTSW 8 116937227 missense probably benign 0.00
R7556:Cenpn UTSW 8 116937269 missense probably damaging 1.00
R8009:Cenpn UTSW 8 116937237 missense probably benign 0.00
R8172:Cenpn UTSW 8 116931594 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ACTCCCTATGTCAGCCTGTG -3'
(R):5'- CATGATGTCTCCTTTGCTAACAAGAG -3'

Sequencing Primer
(F):5'- AAGGCCCTGGACACATCTGAG -3'
(R):5'- TCTCCTTTGCTAACAAGAGAATTAAG -3'
Posted On2020-09-15