Incidental Mutation 'R7961:Neurod4'
ID650123
Institutional Source Beutler Lab
Gene Symbol Neurod4
Ensembl Gene ENSMUSG00000048015
Gene Nameneurogenic differentiation 4
SynonymsbHLHa4, MATH-3, Atoh3, Math3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location130268152-130280240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130270487 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 306 (V306D)
Ref Sequence ENSEMBL: ENSMUSP00000051379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061571
AA Change: V306D

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051379
Gene: ENSMUSG00000048015
AA Change: V306D

DomainStartEndE-ValueType
low complexity region 49 76 N/A INTRINSIC
HLH 93 145 2.21e-16 SMART
Pfam:Neuro_bHLH 146 263 1.3e-41 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: This gene belongs to the neurogenic differentiation factor family and encodes a basic helix-loop-helix (bHLH) transcription factor which is expressed in the developing nervous system with high levels of expression in the brain, retina and cranial ganglions. Expression gradually becomes restricted to the neural retina. It is a key gene in the Ngn2-regulated neuronal differentiation pathway, coordinating the onset of cortical gene transcription. This gene also regulates amacrine cell fate determination in the retina. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, ataxia, and high postnatal mortality. Mutants show impaired postnatal cerebellar development, with thinner inner granular cell and molecular layers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Neurod4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Neurod4 APN 10 130270814 missense probably damaging 0.96
IGL01674:Neurod4 APN 10 130271018 missense probably damaging 1.00
R0347:Neurod4 UTSW 10 130271111 missense probably damaging 1.00
R1436:Neurod4 UTSW 10 130270671 missense possibly damaging 0.87
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1467:Neurod4 UTSW 10 130270604 missense probably benign 0.03
R1965:Neurod4 UTSW 10 130271049 nonsense probably null
R3018:Neurod4 UTSW 10 130270955 missense probably damaging 1.00
R3847:Neurod4 UTSW 10 130270482 missense probably benign
R5491:Neurod4 UTSW 10 130271067 missense possibly damaging 0.95
R5655:Neurod4 UTSW 10 130271133 nonsense probably null
R5705:Neurod4 UTSW 10 130271402 start codon destroyed probably null 0.99
R6143:Neurod4 UTSW 10 130271000 missense probably damaging 1.00
R6800:Neurod4 UTSW 10 130270792 nonsense probably null
R6867:Neurod4 UTSW 10 130270714 missense probably damaging 1.00
R7396:Neurod4 UTSW 10 130271022 missense probably damaging 1.00
R7401:Neurod4 UTSW 10 130271058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGGAAGTTCTGAACAAACTAGGAC -3'
(R):5'- ATCCACCTGACTGCAGTACC -3'

Sequencing Primer
(F):5'- TGTTTGATGCATATCCAAAGGTTC -3'
(R):5'- GCTCCCCTGATTTGGAAA -3'
Posted On2020-09-15