Incidental Mutation 'R7961:Ccng1'
ID650125
Institutional Source Beutler Lab
Gene Symbol Ccng1
Ensembl Gene ENSMUSG00000020326
Gene Namecyclin G1
Synonymscyclin G
MMRRC Submission
Accession Numbers

Genbank: NM_009831

Is this an essential gene? Possibly non essential (E-score: 0.434) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location40748552-40755311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40751269 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 229 (H229Y)
Ref Sequence ENSEMBL: ENSMUSP00000020576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020576]
Predicted Effect probably benign
Transcript: ENSMUST00000020576
AA Change: H229Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020576
Gene: ENSMUSG00000020326
AA Change: H229Y

DomainStartEndE-ValueType
CYCLIN 56 142 3.63e-17 SMART
Meta Mutation Damage Score 0.0977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The eukaryotic cell cycle is governed by cyclin-dependent protein kinases (CDKs) whose activities are regulated by cyclins and CDK inhibitors. The protein encoded by this gene is a member of the cyclin family and contains the cyclin box. The encoded protein lacks the protein destabilizing (PEST) sequence that is present in other family members. Transcriptional activation of this gene can be induced by tumor protein p53. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Depending on the allele, homozygous mutants exhibit increased cellular sensitivity to gamma-irradiation or decreased incidence of induced hepatic tumors. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Ccng1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ccng1 APN 11 40754058 missense probably benign 0.00
IGL01875:Ccng1 APN 11 40752356 missense probably benign 0.09
IGL02986:Ccng1 APN 11 40750863 utr 3 prime probably benign
G5030:Ccng1 UTSW 11 40753802 splice site probably benign
R1375:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1377:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R1715:Ccng1 UTSW 11 40752114 missense probably benign 0.02
R3620:Ccng1 UTSW 11 40752165 missense probably benign 0.01
R3857:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R3858:Ccng1 UTSW 11 40753833 missense probably damaging 0.99
R5082:Ccng1 UTSW 11 40752188 missense possibly damaging 0.77
R5172:Ccng1 UTSW 11 40751286 missense probably benign
R5521:Ccng1 UTSW 11 40752266 missense possibly damaging 0.87
R7431:Ccng1 UTSW 11 40753918 missense possibly damaging 0.74
R8009:Ccng1 UTSW 11 40751269 missense probably benign 0.00
T0975:Ccng1 UTSW 11 40754044 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCAAATCTCGGCCACTTATC -3'
(R):5'- CTGCAGGATCATATTTTCTAAGGC -3'

Sequencing Primer
(F):5'- AAATCTCGGCCACTTATCTGTAC -3'
(R):5'- CAGGATCATATTTTCTAAGGCAAAGG -3'
Posted On2020-09-15