Incidental Mutation 'R7961:Nubpl'
ID650129
Institutional Source Beutler Lab
Gene Symbol Nubpl
Ensembl Gene ENSMUSG00000035142
Gene Namenucleotide binding protein-like
Synonyms2410170E07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location52097737-52312744 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 52181297 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 168 (L168*)
Ref Sequence ENSEMBL: ENSMUSP00000044292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040090] [ENSMUST00000159567]
Predicted Effect probably null
Transcript: ENSMUST00000040090
AA Change: L168*
SMART Domains Protein: ENSMUSP00000044292
Gene: ENSMUSG00000035142
AA Change: L168*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ParA 65 311 1.6e-101 PFAM
Pfam:AAA_31 68 131 2.6e-9 PFAM
Pfam:MipZ 68 217 2.8e-9 PFAM
Pfam:CbiA 70 241 9.9e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159567
AA Change: L116*
SMART Domains Protein: ENSMUSP00000125177
Gene: ENSMUSG00000035142
AA Change: L116*

DomainStartEndE-ValueType
PDB:2PH1|A 12 113 4e-9 PDB
SCOP:d1ihua2 31 122 3e-7 SMART
Blast:AAA 40 115 1e-23 BLAST
Meta Mutation Damage Score 0.9706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Nubpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Nubpl APN 12 52305855 missense probably damaging 0.96
IGL01415:Nubpl APN 12 52271070 missense possibly damaging 0.91
IGL02538:Nubpl APN 12 52310694 splice site probably benign
IGL02644:Nubpl APN 12 52271058 missense probably damaging 0.99
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R3851:Nubpl UTSW 12 52144027 missense probably damaging 1.00
R4939:Nubpl UTSW 12 52181095 missense probably damaging 0.98
R5553:Nubpl UTSW 12 52181299 missense possibly damaging 0.90
R5691:Nubpl UTSW 12 52105276 intron probably benign
R5886:Nubpl UTSW 12 52181309 critical splice donor site probably null
R6654:Nubpl UTSW 12 52310733 missense probably damaging 1.00
R6899:Nubpl UTSW 12 52310753 missense probably benign
R7274:Nubpl UTSW 12 52132420 intron probably benign
Z1177:Nubpl UTSW 12 52098362 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCTAATGAGGCCTCTTTTGAATTATGG -3'
(R):5'- TGTTACACTAAGATGCAACAGGAAG -3'

Sequencing Primer
(F):5'- AGGCCTCTTTTGAATTATGGTATTGC -3'
(R):5'- CAGGAAGACTAAGTTGGTGTAATTTG -3'
Posted On2020-09-15