Incidental Mutation 'R7961:Odf1'
ID650136
Institutional Source Beutler Lab
Gene Symbol Odf1
Ensembl Gene ENSMUSG00000061923
Gene Nameouter dense fiber of sperm tails 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location38219203-38226735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38226596 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 247 (I247V)
Ref Sequence ENSEMBL: ENSMUSP00000080632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081966]
Predicted Effect unknown
Transcript: ENSMUST00000081966
AA Change: I247V
SMART Domains Protein: ENSMUSP00000080632
Gene: ENSMUSG00000061923
AA Change: I247V

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
internal_repeat_1 35 47 2.51e-7 PROSPERO
internal_repeat_1 45 57 2.51e-7 PROSPERO
low complexity region 67 96 N/A INTRINSIC
Pfam:HSP20 110 187 4.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The outer dense fibers are cytoskeletal structures that surround the axoneme in the middle piece and principal piece of the sperm tail. The fibers function in maintaining the elastic structure and recoil of the sperm tail as well as in protecting the tail from shear forces during epididymal transport and ejaculation. Defects in the outer dense fibers lead to abnormal sperm morphology and infertility. The human outer dense fibers contains at least 10 major proteins and this gene encodes the main protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with asthenozoospermia, oligozoospermia, detached sperm head and absent acrosome reaction. Mice heterozygous for this allele exhibit asthenozoospermia without altered fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Odf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02108:Odf1 APN 15 38226379 nonsense probably null
R3017:Odf1 UTSW 15 38226431 missense unknown
R4967:Odf1 UTSW 15 38226408 missense probably damaging 0.98
R5134:Odf1 UTSW 15 38226149 missense possibly damaging 0.68
R5319:Odf1 UTSW 15 38219619 missense probably benign 0.00
R5951:Odf1 UTSW 15 38226287 missense probably damaging 0.99
R7095:Odf1 UTSW 15 38219559 missense possibly damaging 0.86
R7197:Odf1 UTSW 15 38219550 missense probably benign 0.00
R8009:Odf1 UTSW 15 38226596 missense unknown
Z1088:Odf1 UTSW 15 38219674 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCGGCAGCTGTGTCAAGATC -3'
(R):5'- AGTGTCCTGGAATGCTTCTG -3'

Sequencing Primer
(F):5'- CAGCTGTGTCAAGATCGAGTCTC -3'
(R):5'- TAGCTAACTCTGTAGGGAGTCAAACC -3'
Posted On2020-09-15