Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Krt71'

650137

Institutional Source

Beutler Lab

Gene Symbol

Krt71

Ensembl Gene

ENSMUSG00000051879

Gene Name

keratin 71

Synonyms

Cu, mK6irs, Krt2-6g, mK6irs1, Ca, Cal4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101733949-101743109 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101735442 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 454 (I454V)

Ref Sequence

ENSEMBL: ENSMUSP00000023710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023710]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023710
AA Change: I454V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023710
Gene: ENSMUSG00000051879
AA Change: I454V

Domain	Start	End	E-Value	Type
low complexity region	17	55	N/A	INTRINSIC
Pfam:Keratin_2_head	59	127	1.6e-20	PFAM
Filament	130	443	1.19e-151	SMART
low complexity region	449	465	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mutations in this gene result in waved hair and curly vibrissae. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Krt71

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Krt71	APN	15	101736674	missense	probably damaging	1.00
IGL03076:Krt71	APN	15	101734597	missense	probably benign	0.00
IGL03390:Krt71	APN	15	101734552	missense	possibly damaging	0.93
R0040:Krt71	UTSW	15	101738433	missense	possibly damaging	0.90
R0040:Krt71	UTSW	15	101738433	missense	possibly damaging	0.90
R0041:Krt71	UTSW	15	101739318	missense	probably damaging	1.00
R0153:Krt71	UTSW	15	101734706	missense	possibly damaging	0.65
R0376:Krt71	UTSW	15	101738070	missense	probably damaging	1.00
R0932:Krt71	UTSW	15	101736760	missense	probably benign	0.20
R1263:Krt71	UTSW	15	101735466	missense	probably damaging	1.00
R1646:Krt71	UTSW	15	101738764	splice site	probably null
R1796:Krt71	UTSW	15	101742880	missense	possibly damaging	0.68
R1954:Krt71	UTSW	15	101735466	nonsense	probably null
R3001:Krt71	UTSW	15	101740471	splice site	probably benign
R3793:Krt71	UTSW	15	101742910	missense	probably damaging	1.00
R4236:Krt71	UTSW	15	101734694	missense	probably benign	0.09
R4751:Krt71	UTSW	15	101735466	missense	probably damaging	1.00
R6445:Krt71	UTSW	15	101740340	missense	probably benign	0.06
R7034:Krt71	UTSW	15	101738337	missense	probably benign	0.41
R7036:Krt71	UTSW	15	101738337	missense	probably benign	0.41
R7378:Krt71	UTSW	15	101738329	nonsense	probably null
R7942:Krt71	UTSW	15	101735459	missense	probably damaging	0.99
R8026:Krt71	UTSW	15	101738382	missense	possibly damaging	0.66
R8131:Krt71	UTSW	15	101734706	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- AGAGGCTCTCCCTTACTACC -3'
(R):5'- ATCTCAGGCTGATGGCATTG -3'

Sequencing Primer
(F):5'- CCCCTGGGAGGCAGAATGATG -3'
(R):5'- GAAGATGCTATGGGCTCT -3'

Posted On

2020-09-15