Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Usp25'

650138

Institutional Source

Beutler Lab

Gene Symbol

Usp25

Ensembl Gene

ENSMUSG00000022867

Gene Name

ubiquitin specific peptidase 25

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77013706-77116780 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 77059262 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 248 (I248V)

Ref Sequence

ENSEMBL: ENSMUSP00000023580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023580]

PDB Structure

Solution Structure of RSGI RUH-013, a UBA domain in Mouse cDNA [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023580
AA Change: I248V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000023580
Gene: ENSMUSG00000022867
AA Change: I248V

Domain	Start	End	E-Value	Type
PDB:1VDL\|A	1	67	2e-35	PDB
Blast:UBA	17	56	9e-16	BLAST
UIM	97	116	5.27e-3	SMART
Pfam:UIM	124	140	6.7e-3	PFAM
Pfam:UCH	168	655	9.3e-55	PFAM
Pfam:UCH_1	169	632	3.1e-14	PFAM
coiled coil region	685	714	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ubiquitin (MIM 191339) is a highly conserved 76-amino acid protein involved in regulation of intracellular protein breakdown, cell cycle regulation, and stress response. Ubiquitin is released from degraded proteins by disassembly of the polyubiquitin chains, which is mediated by ubiquitin-specific proteases (USPs), such as USP25 (Valero et al., 1999 [PubMed 10644437]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased severity of IL17-induced pulmonary inflammation and MOG-induced experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt1	T	A	19: 25,545,881	S199T	possibly damaging	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Usp25

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Usp25	APN	16	77062405	missense	probably damaging	1.00
IGL01359:Usp25	APN	16	77059253	missense	probably damaging	1.00
IGL01380:Usp25	APN	16	77093678	missense	probably benign	0.06
IGL01614:Usp25	APN	16	77077117	missense	probably damaging	1.00
IGL02065:Usp25	APN	16	77083782	missense	probably benign	0.06
IGL02271:Usp25	APN	16	77115447	missense	probably damaging	1.00
IGL03184:Usp25	APN	16	77081653	missense	probably damaging	1.00
IGL03046:Usp25	UTSW	16	77074866	missense	probably damaging	1.00
R0433:Usp25	UTSW	16	77109217	missense	probably benign	0.02
R0741:Usp25	UTSW	16	77071708	missense	possibly damaging	0.80
R0944:Usp25	UTSW	16	77081447	splice site	probably benign
R1324:Usp25	UTSW	16	77080387	missense	probably damaging	0.98
R1341:Usp25	UTSW	16	77115443	missense	probably benign
R1373:Usp25	UTSW	16	77062385	splice site	probably benign
R1641:Usp25	UTSW	16	77071671	missense	possibly damaging	0.89
R1777:Usp25	UTSW	16	77081554	missense	probably damaging	1.00
R1813:Usp25	UTSW	16	77114950	missense	probably benign	0.00
R1960:Usp25	UTSW	16	77076371	missense	probably damaging	1.00
R2256:Usp25	UTSW	16	77113794	missense	probably benign
R2271:Usp25	UTSW	16	77076429	missense	probably damaging	0.97
R4404:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4408:Usp25	UTSW	16	77115453	missense	probably damaging	1.00
R4502:Usp25	UTSW	16	77115396	missense	probably damaging	1.00
R4604:Usp25	UTSW	16	77115415	missense	probably damaging	1.00
R4612:Usp25	UTSW	16	77033945	missense	possibly damaging	0.92
R4744:Usp25	UTSW	16	77114989	missense	probably damaging	1.00
R4867:Usp25	UTSW	16	77050467	missense	probably damaging	1.00
R4932:Usp25	UTSW	16	77033982	critical splice donor site	probably null
R5087:Usp25	UTSW	16	77077119	missense	probably benign	0.00
R5165:Usp25	UTSW	16	77076405	missense	possibly damaging	0.85
R5184:Usp25	UTSW	16	77109227	missense	probably benign	0.00
R5307:Usp25	UTSW	16	77093706	missense	probably benign
R5331:Usp25	UTSW	16	77050558	missense	probably damaging	1.00
R5355:Usp25	UTSW	16	77050454	missense	probably damaging	1.00
R5479:Usp25	UTSW	16	77107913	missense	possibly damaging	0.51
R5619:Usp25	UTSW	16	77033945	missense	probably benign	0.22
R5646:Usp25	UTSW	16	77050472	missense	probably benign	0.34
R5946:Usp25	UTSW	16	77115054	nonsense	probably null
R6013:Usp25	UTSW	16	77077021	missense	probably benign	0.00
R6418:Usp25	UTSW	16	77062442	missense	probably damaging	1.00
R6653:Usp25	UTSW	16	77059288	missense	probably benign	0.29
R6709:Usp25	UTSW	16	77083932	missense	probably benign
R6987:Usp25	UTSW	16	77077180	missense	probably damaging	1.00
R7418:Usp25	UTSW	16	77113842	nonsense	probably null
R7500:Usp25	UTSW	16	77077201	missense	probably damaging	1.00
R7886:Usp25	UTSW	16	77113771	missense	probably damaging	0.99
R8005:Usp25	UTSW	16	77077068	missense	probably benign
R8046:Usp25	UTSW	16	77109175	missense	probably damaging	1.00
R8069:Usp25	UTSW	16	77069055	missense	possibly damaging	0.58
R8140:Usp25	UTSW	16	77071681	nonsense	probably null
R8167:Usp25	UTSW	16	77107931	missense	probably damaging	1.00
R8437:Usp25	UTSW	16	77033912	missense	probably damaging	1.00
X0065:Usp25	UTSW	16	77081556	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77071791	missense	probably damaging	0.98
Z1176:Usp25	UTSW	16	77071792	missense	possibly damaging	0.93
Z1176:Usp25	UTSW	16	77081521	missense	probably damaging	1.00
Z1176:Usp25	UTSW	16	77083913	missense	probably benign
Z1176:Usp25	UTSW	16	77113830	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCGCCTCCTGTTGAAGTATTGG -3'
(R):5'- CATCATTCTACAAATTACCCATGCAC -3'

Sequencing Primer
(F):5'- CCTCCTGTTGAAGTATTGGTTGATG -3'
(R):5'- CCTCCCAGGTGCTAGGATTAAAG -3'

Posted On

2020-09-15