Mutagenetix > Incidental Mutations

Incidental Mutation 'R7961:Dmrt1'

650140

Institutional Source

Beutler Lab

Gene Symbol

Dmrt1

Ensembl Gene

ENSMUSG00000024837

Gene Name

doublesex and mab-3 related transcription factor 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.619) question?

Stock #

R7961 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25505618-25604329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25545881 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 199 (S199T)

Ref Sequence

ENSEMBL: ENSMUSP00000025755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025755] [ENSMUST00000087525]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025755
AA Change: S199T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000025755
Gene: ENSMUSG00000024837
AA Change: S199T

Domain	Start	End	E-Value	Type
low complexity region	17	68	N/A	INTRINSIC
DM	70	123	1.51e-25	SMART
Pfam:Dmrt1	128	200	2.3e-37	PFAM
low complexity region	219	226	N/A	INTRINSIC
low complexity region	326	346	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087525

SMART Domains

Protein: ENSMUSP00000084803
Gene: ENSMUSG00000024837

Domain	Start	End	E-Value	Type
low complexity region	17	68	N/A	INTRINSIC
DM	70	123	1.51e-25	SMART
Pfam:Dmrt1	128	185	1.2e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160814

Meta Mutation Damage Score

0.1712

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

94% (44/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is found in a cluster with two other members of the gene family, having in common a zinc finger-like DNA-binding motif (DM domain). The DM domain is an ancient, conserved component of the vertebrate sex-determining pathway that is also a key regulator of male development in flies and nematodes. This gene exhibits a gonad-specific and sexually dimorphic expression pattern. Defective testicular development and XY feminization occur when this gene is hemizygous. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for null mutations are sterile and exhibit a complete loss of germ cells between postnatal days 7-14, disorganized seminiferous tubules, and degeneration of Leydig cells. Females are normal and fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	T	A	5: 8,828,870	N751K	possibly damaging	Het
Bckdha	G	A	7: 25,631,478	R288W	probably damaging	Het
C87414	T	C	5: 93,636,684	D307G	probably damaging	Het
Ccng1	G	A	11: 40,751,269	H229Y	probably benign	Het
Cenpn	C	A	8: 116,937,237	T256N	probably benign	Het
Ciart	A	G	3: 95,881,317	V70A	possibly damaging	Het
Clcc1	A	G	3: 108,661,458	N36S	probably damaging	Het
Cntnap1	G	A	11: 101,178,295	A192T	probably benign	Het
Dmrt3	T	C	19: 25,610,908	V37A	possibly damaging	Het
Dock1	T	A	7: 134,745,057	D239E	possibly damaging	Het
Dyrk3	A	G	1: 131,136,258		probably null	Het
Engase	A	G	11: 118,486,860	D571G	possibly damaging	Het
Gm45871	C	T	18: 90,591,759	H374Y	probably damaging	Het
Icam5	T	C	9: 21,038,755	V870A	possibly damaging	Het
Idh2	T	C	7: 80,098,253	H233R	probably benign	Het
Kcna5	A	G	6: 126,533,554	L537P	probably benign	Het
Krt71	T	C	15: 101,735,442	I454V	probably damaging	Het
Krtap5-4	C	T	7: 142,303,934	Q114*	probably null	Het
Loxl3	T	C	6: 83,050,809	F734S	possibly damaging	Het
Lpcat1	C	T	13: 73,511,379	T420I	probably damaging	Het
Mia2	T	A	12: 59,159,639		probably null	Het
Neurod4	A	T	10: 130,270,487	V306D	possibly damaging	Het
Nkiras2	A	T	11: 100,619,802		probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Ntrk3	T	A	7: 78,453,328	D408V	probably benign	Het
Nubpl	T	A	12: 52,181,297	L168*	probably null	Het
Odf1	A	G	15: 38,226,596	I247V	unknown	Het
Olfr1170	C	A	2: 88,224,689	M114I	possibly damaging	Het
Olfr1260	A	G	2: 89,977,787	Q3R	probably benign	Het
Olfr1298	G	A	2: 111,645,937	S20F	probably damaging	Het
Pcsk1	T	C	13: 75,126,839	S516P	probably benign	Het
Pikfyve	A	G	1: 65,255,134	D1411G	probably damaging	Het
Polm	T	C	11: 5,830,155	D294G	possibly damaging	Het
Ppcs	A	T	4: 119,419,065	S281T	probably benign	Het
Pspc1	G	A	14: 56,771,847	Q177*	probably null	Het
Rbm33	G	A	5: 28,394,608	G185R		Het
Satb2	A	G	1: 56,871,758	S243P	probably benign	Het
Serinc5	T	C	13: 92,661,191		probably null	Het
Sgsm1	T	C	5: 113,282,644	T292A	probably damaging	Het
Smad3	G	A	9: 63,650,282	R420C	possibly damaging	Het
Sntg1	C	T	1: 8,363,570	V486I	probably damaging	Het
Tep1	A	G	14: 50,824,230	S2610P	possibly damaging	Het
Tmem200a	A	G	10: 25,994,006	S122P	probably damaging	Het
Tnks2	T	A	19: 36,852,501	M194K	probably benign	Het
Trav14d-3-dv8	A	C	14: 53,078,767	Q28P	probably damaging	Het
Trpm5	T	C	7: 143,080,369	E700G	probably benign	Het
Ubqln3	T	A	7: 104,142,590	I98L	probably benign	Het
Usp25	A	G	16: 77,059,262	I248V	probably damaging	Het
Vmn1r28	T	C	6: 58,265,193	V7A	probably benign	Het
Zfp60	G	A	7: 27,748,456	G183D	probably benign	Het

Other mutations in Dmrt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Dmrt1	APN	19	25603274	missense	probably damaging	0.98
IGL03167:Dmrt1	APN	19	25545893	missense	possibly damaging	0.66
R0325:Dmrt1	UTSW	19	25546007	missense	probably benign	0.39
R0410:Dmrt1	UTSW	19	25506103	missense	probably damaging	1.00
R1834:Dmrt1	UTSW	19	25509699	missense	probably damaging	0.99
R2830:Dmrt1	UTSW	19	25603294	missense	probably benign	0.01
R4696:Dmrt1	UTSW	19	25603310	missense	possibly damaging	0.88
R4869:Dmrt1	UTSW	19	25505855	start codon destroyed	probably null	0.02
R4870:Dmrt1	UTSW	19	25505855	start codon destroyed	probably null	0.02
R5477:Dmrt1	UTSW	19	25509800	missense	probably benign	0.01
R5989:Dmrt1	UTSW	19	25545881	missense	possibly damaging	0.75
R6490:Dmrt1	UTSW	19	25546031	missense	possibly damaging	0.50
R6590:Dmrt1	UTSW	19	25546085	missense	probably benign
R6690:Dmrt1	UTSW	19	25546085	missense	probably benign
R7911:Dmrt1	UTSW	19	25603328	missense	probably benign	0.01
R7920:Dmrt1	UTSW	19	25506019	missense	possibly damaging	0.73
R8009:Dmrt1	UTSW	19	25545881	missense	possibly damaging	0.75
X0064:Dmrt1	UTSW	19	25545891	missense	probably damaging	1.00
Z1176:Dmrt1	UTSW	19	25559970	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- AAGGCAAGATCTGTGGACCG -3'
(R):5'- CTGGTTTCCAGTCTGAGCAG -3'

Sequencing Primer
(F):5'- GATCTGTGGACCGCCTACATTAAATC -3'
(R):5'- TTTCCAGTCTGAGCAGGCACG -3'

Posted On

2020-09-15