Incidental Mutation 'R7961:Dmrt1'
ID650140
Institutional Source Beutler Lab
Gene Symbol Dmrt1
Ensembl Gene ENSMUSG00000024837
Gene Namedoublesex and mab-3 related transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location25505618-25604329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25545881 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 199 (S199T)
Ref Sequence ENSEMBL: ENSMUSP00000025755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025755] [ENSMUST00000087525]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025755
AA Change: S199T

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025755
Gene: ENSMUSG00000024837
AA Change: S199T

DomainStartEndE-ValueType
low complexity region 17 68 N/A INTRINSIC
DM 70 123 1.51e-25 SMART
Pfam:Dmrt1 128 200 2.3e-37 PFAM
low complexity region 219 226 N/A INTRINSIC
low complexity region 326 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087525
SMART Domains Protein: ENSMUSP00000084803
Gene: ENSMUSG00000024837

DomainStartEndE-ValueType
low complexity region 17 68 N/A INTRINSIC
DM 70 123 1.51e-25 SMART
Pfam:Dmrt1 128 185 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160814
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is found in a cluster with two other members of the gene family, having in common a zinc finger-like DNA-binding motif (DM domain). The DM domain is an ancient, conserved component of the vertebrate sex-determining pathway that is also a key regulator of male development in flies and nematodes. This gene exhibits a gonad-specific and sexually dimorphic expression pattern. Defective testicular development and XY feminization occur when this gene is hemizygous. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for null mutations are sterile and exhibit a complete loss of germ cells between postnatal days 7-14, disorganized seminiferous tubules, and degeneration of Leydig cells. Females are normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Tnks2 T A 19: 36,852,501 M194K probably benign Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Dmrt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Dmrt1 APN 19 25603274 missense probably damaging 0.98
IGL03167:Dmrt1 APN 19 25545893 missense possibly damaging 0.66
R0325:Dmrt1 UTSW 19 25546007 missense probably benign 0.39
R0410:Dmrt1 UTSW 19 25506103 missense probably damaging 1.00
R1834:Dmrt1 UTSW 19 25509699 missense probably damaging 0.99
R2830:Dmrt1 UTSW 19 25603294 missense probably benign 0.01
R4696:Dmrt1 UTSW 19 25603310 missense possibly damaging 0.88
R4869:Dmrt1 UTSW 19 25505855 start codon destroyed probably null 0.02
R4870:Dmrt1 UTSW 19 25505855 start codon destroyed probably null 0.02
R5477:Dmrt1 UTSW 19 25509800 missense probably benign 0.01
R5989:Dmrt1 UTSW 19 25545881 missense possibly damaging 0.75
R6490:Dmrt1 UTSW 19 25546031 missense possibly damaging 0.50
R6590:Dmrt1 UTSW 19 25546085 missense probably benign
R6690:Dmrt1 UTSW 19 25546085 missense probably benign
R7911:Dmrt1 UTSW 19 25603328 missense probably benign 0.01
R7920:Dmrt1 UTSW 19 25506019 missense possibly damaging 0.73
R8009:Dmrt1 UTSW 19 25545881 missense possibly damaging 0.75
X0064:Dmrt1 UTSW 19 25545891 missense probably damaging 1.00
Z1176:Dmrt1 UTSW 19 25559970 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AAGGCAAGATCTGTGGACCG -3'
(R):5'- CTGGTTTCCAGTCTGAGCAG -3'

Sequencing Primer
(F):5'- GATCTGTGGACCGCCTACATTAAATC -3'
(R):5'- TTTCCAGTCTGAGCAGGCACG -3'
Posted On2020-09-15