Incidental Mutation 'R7961:Tnks2'
ID650142
Institutional Source Beutler Lab
Gene Symbol Tnks2
Ensembl Gene ENSMUSG00000024811
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7961 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location36834232-36893477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36852501 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 194 (M194K)
Ref Sequence ENSEMBL: ENSMUSP00000025729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025729]
Predicted Effect probably benign
Transcript: ENSMUST00000025729
AA Change: M194K

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025729
Gene: ENSMUSG00000024811
AA Change: M194K

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ANK 57 86 8.07e-5 SMART
ANK 90 119 1.78e-6 SMART
ANK 123 152 6.46e-4 SMART
ANK 210 239 1.76e-5 SMART
ANK 243 272 3.91e-3 SMART
ANK 276 305 3.23e-4 SMART
ANK 363 395 1.57e-2 SMART
ANK 399 428 4.5e-3 SMART
ANK 432 461 4.89e-4 SMART
ANK 525 554 1.43e-5 SMART
ANK 558 587 6.55e-5 SMART
ANK 591 620 1.24e-5 SMART
low complexity region 641 659 N/A INTRINSIC
ANK 678 707 1.69e-7 SMART
ANK 711 740 3.65e-3 SMART
ANK 744 773 3.36e-2 SMART
low complexity region 822 863 N/A INTRINSIC
SAM 870 936 1.03e-10 SMART
Pfam:PARP 952 1157 4.9e-28 PFAM
Meta Mutation Damage Score 0.2058 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 94% (44/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable but display decreased body weight and abnormal adipocyte glucose uptake in response to insulin stimulation. Mice homozygous for a different null allele show partial postnatal lethality as well as decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T A 5: 8,828,870 N751K possibly damaging Het
Bckdha G A 7: 25,631,478 R288W probably damaging Het
C87414 T C 5: 93,636,684 D307G probably damaging Het
Ccng1 G A 11: 40,751,269 H229Y probably benign Het
Cenpn C A 8: 116,937,237 T256N probably benign Het
Ciart A G 3: 95,881,317 V70A possibly damaging Het
Clcc1 A G 3: 108,661,458 N36S probably damaging Het
Cntnap1 G A 11: 101,178,295 A192T probably benign Het
Dmrt1 T A 19: 25,545,881 S199T possibly damaging Het
Dmrt3 T C 19: 25,610,908 V37A possibly damaging Het
Dock1 T A 7: 134,745,057 D239E possibly damaging Het
Dyrk3 A G 1: 131,136,258 probably null Het
Engase A G 11: 118,486,860 D571G possibly damaging Het
Gm45871 C T 18: 90,591,759 H374Y probably damaging Het
Icam5 T C 9: 21,038,755 V870A possibly damaging Het
Idh2 T C 7: 80,098,253 H233R probably benign Het
Kcna5 A G 6: 126,533,554 L537P probably benign Het
Krt71 T C 15: 101,735,442 I454V probably damaging Het
Krtap5-4 C T 7: 142,303,934 Q114* probably null Het
Loxl3 T C 6: 83,050,809 F734S possibly damaging Het
Lpcat1 C T 13: 73,511,379 T420I probably damaging Het
Mia2 T A 12: 59,159,639 probably null Het
Neurod4 A T 10: 130,270,487 V306D possibly damaging Het
Nkiras2 A T 11: 100,619,802 probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Ntrk3 T A 7: 78,453,328 D408V probably benign Het
Nubpl T A 12: 52,181,297 L168* probably null Het
Odf1 A G 15: 38,226,596 I247V unknown Het
Olfr1170 C A 2: 88,224,689 M114I possibly damaging Het
Olfr1260 A G 2: 89,977,787 Q3R probably benign Het
Olfr1298 G A 2: 111,645,937 S20F probably damaging Het
Pcsk1 T C 13: 75,126,839 S516P probably benign Het
Pikfyve A G 1: 65,255,134 D1411G probably damaging Het
Polm T C 11: 5,830,155 D294G possibly damaging Het
Ppcs A T 4: 119,419,065 S281T probably benign Het
Pspc1 G A 14: 56,771,847 Q177* probably null Het
Rbm33 G A 5: 28,394,608 G185R Het
Satb2 A G 1: 56,871,758 S243P probably benign Het
Serinc5 T C 13: 92,661,191 probably null Het
Sgsm1 T C 5: 113,282,644 T292A probably damaging Het
Smad3 G A 9: 63,650,282 R420C possibly damaging Het
Sntg1 C T 1: 8,363,570 V486I probably damaging Het
Tep1 A G 14: 50,824,230 S2610P possibly damaging Het
Tmem200a A G 10: 25,994,006 S122P probably damaging Het
Trav14d-3-dv8 A C 14: 53,078,767 Q28P probably damaging Het
Trpm5 T C 7: 143,080,369 E700G probably benign Het
Ubqln3 T A 7: 104,142,590 I98L probably benign Het
Usp25 A G 16: 77,059,262 I248V probably damaging Het
Vmn1r28 T C 6: 58,265,193 V7A probably benign Het
Zfp60 G A 7: 27,748,456 G183D probably benign Het
Other mutations in Tnks2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Tnks2 APN 19 36871633 missense probably benign 0.00
IGL01977:Tnks2 APN 19 36872590 critical splice donor site probably null
IGL02389:Tnks2 APN 19 36884103 missense probably benign 0.32
IGL02653:Tnks2 APN 19 36872451 missense probably damaging 1.00
IGL02678:Tnks2 APN 19 36845743 missense possibly damaging 0.63
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0053:Tnks2 UTSW 19 36875365 missense probably damaging 1.00
R0426:Tnks2 UTSW 19 36852821 missense probably damaging 1.00
R0436:Tnks2 UTSW 19 36849358 missense possibly damaging 0.51
R0591:Tnks2 UTSW 19 36872562 missense probably damaging 0.99
R0648:Tnks2 UTSW 19 36862074 splice site probably null
R0894:Tnks2 UTSW 19 36890050 critical splice donor site probably null
R1397:Tnks2 UTSW 19 36880501 splice site probably benign
R1459:Tnks2 UTSW 19 36845531 splice site probably benign
R1674:Tnks2 UTSW 19 36871622 missense probably benign 0.03
R1742:Tnks2 UTSW 19 36876261 missense probably damaging 1.00
R1928:Tnks2 UTSW 19 36845668 nonsense probably null
R2025:Tnks2 UTSW 19 36866066 missense probably damaging 0.99
R2898:Tnks2 UTSW 19 36872590 critical splice donor site probably null
R4422:Tnks2 UTSW 19 36845653 missense probably damaging 1.00
R4676:Tnks2 UTSW 19 36875271 nonsense probably null
R5202:Tnks2 UTSW 19 36888852 missense probably damaging 1.00
R5357:Tnks2 UTSW 19 36849290 splice site silent
R5467:Tnks2 UTSW 19 36881776 missense probably damaging 1.00
R5550:Tnks2 UTSW 19 36862346 missense probably damaging 1.00
R6119:Tnks2 UTSW 19 36879352 missense possibly damaging 0.79
R6219:Tnks2 UTSW 19 36866204 intron probably benign
R7270:Tnks2 UTSW 19 36859145 missense
R7309:Tnks2 UTSW 19 36852536 missense probably damaging 1.00
R7310:Tnks2 UTSW 19 36879439 missense probably benign 0.12
R7516:Tnks2 UTSW 19 36871664 missense possibly damaging 0.85
R7823:Tnks2 UTSW 19 36852554 critical splice donor site probably null
R7951:Tnks2 UTSW 19 36862155 missense
R8009:Tnks2 UTSW 19 36852501 missense probably benign 0.15
R8193:Tnks2 UTSW 19 36854953 missense possibly damaging 0.70
Z1177:Tnks2 UTSW 19 36834577 missense probably benign 0.20
Z1177:Tnks2 UTSW 19 36888880 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTAATGAGATCTGACGCCC -3'
(R):5'- ATGGAGTTGACTGAAACAGTAACC -3'

Sequencing Primer
(F):5'- GTAATGAGATCTGACGCCCTCTTTTG -3'
(R):5'- AGAAAATCTAACCATGAGCTCATTG -3'
Posted On2020-09-15