Incidental Mutation 'R7962:Tmprss11a'
ID650155
Institutional Source Beutler Lab
Gene Symbol Tmprss11a
Ensembl Gene ENSMUSG00000072845
Gene Nametransmembrane protease, serine 11a
SynonymsLOC194597
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location86410410-86468990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86420020 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 283 (G283R)
Ref Sequence ENSEMBL: ENSMUSP00000098634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101073]
Predicted Effect probably damaging
Transcript: ENSMUST00000101073
AA Change: G283R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098634
Gene: ENSMUSG00000072845
AA Change: G283R

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
Pfam:SEA 36 135 3.2e-23 PFAM
Tryp_SPc 157 383 1.98e-87 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Tmprss11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Tmprss11a APN 5 86422519 missense probably damaging 1.00
IGL02413:Tmprss11a APN 5 86422648 missense possibly damaging 0.50
IGL02533:Tmprss11a APN 5 86414527 missense probably damaging 0.96
R1202:Tmprss11a UTSW 5 86411925 critical splice acceptor site probably null
R1273:Tmprss11a UTSW 5 86414588 missense probably benign 0.10
R1704:Tmprss11a UTSW 5 86428702 missense probably benign 0.25
R1756:Tmprss11a UTSW 5 86420179 missense probably damaging 1.00
R1783:Tmprss11a UTSW 5 86420032 missense probably damaging 0.98
R1967:Tmprss11a UTSW 5 86431843 missense probably benign 0.23
R2944:Tmprss11a UTSW 5 86428652 missense probably benign 0.19
R3881:Tmprss11a UTSW 5 86445805 missense possibly damaging 0.85
R4512:Tmprss11a UTSW 5 86428578 missense probably benign 0.00
R4515:Tmprss11a UTSW 5 86420196 missense probably damaging 1.00
R4530:Tmprss11a UTSW 5 86428681 missense possibly damaging 0.79
R4543:Tmprss11a UTSW 5 86411809 nonsense probably null
R4881:Tmprss11a UTSW 5 86422573 missense probably damaging 1.00
R5066:Tmprss11a UTSW 5 86420000 critical splice donor site probably null
R5186:Tmprss11a UTSW 5 86420079 missense probably damaging 1.00
R5254:Tmprss11a UTSW 5 86411806 missense probably damaging 0.99
R5313:Tmprss11a UTSW 5 86411815 missense probably damaging 1.00
R6516:Tmprss11a UTSW 5 86420128 missense probably damaging 1.00
R6920:Tmprss11a UTSW 5 86428635 missense probably benign 0.23
R7018:Tmprss11a UTSW 5 86428570 missense probably damaging 0.96
R7566:Tmprss11a UTSW 5 86444134 missense possibly damaging 0.50
X0057:Tmprss11a UTSW 5 86445808 missense probably benign 0.03
X0063:Tmprss11a UTSW 5 86414578 missense probably damaging 1.00
Z1176:Tmprss11a UTSW 5 86428631 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTGTATGGCAGTGAGCTAC -3'
(R):5'- CTCCCTTAATGAAAAGAGACGTCAG -3'

Sequencing Primer
(F):5'- GACAGTTTTCCAGGGTTCAGCAAC -3'
(R):5'- AGAGACGTCAGAAGAATTATTATGC -3'
Posted On2020-09-15