Incidental Mutation 'R7962:Smok3c'
ID650157
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Namesperm motility kinase 3C
SynonymsEG622486
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location138053194-138066537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 138065079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 276 (V276D)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
Predicted Effect probably damaging
Transcript: ENSMUST00000110967
AA Change: V276D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: V276D

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178402
AA Change: V276D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: V276D

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138065393 missense probably benign 0.00
R8381:Smok3c UTSW 5 138065562 missense probably benign
R8841:Smok3c UTSW 5 138065275 missense probably damaging 0.99
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGCCCAAGATCGATGTATG -3'
(R):5'- TTCAGTAGACAATAAGACGCCATGG -3'

Sequencing Primer
(F):5'- CCCAAGATCGATGTATGGACTCTTG -3'
(R):5'- CATGGTTTGGTTGAATTTTCTCTGAC -3'
Posted On2020-09-15