Mutagenetix > Incidental Mutations

Incidental Mutation 'R7962:Rassf8'

650164

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R7962 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 145815943 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably null
Transcript: ENSMUST00000032388

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058538

Predicted Effect

probably null
Transcript: ENSMUST00000111704

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210010C04Rik	A	C	6: 41,035,453	F9C	probably benign	Het
Adgrg6	A	G	10: 14,420,684	F991L	probably damaging	Het
Ahnak	A	G	19: 9,012,800	D3816G	unknown	Het
Arhgdig	T	C	17: 26,199,634	T153A	probably damaging	Het
Ash2l	T	C	8: 25,839,764	D122G	probably damaging	Het
Bora	A	G	14: 99,072,726	K497R	probably benign	Het
Btbd9	T	C	17: 30,517,203	H312R	probably damaging	Het
Cbr2	T	C	11: 120,729,783	D225G	probably benign	Het
Cemip	C	A	7: 84,003,408		probably benign	Het
Cfap70	G	A	14: 20,436,786	T275M	probably benign	Het
Clca4b	T	C	3: 144,916,660	D548G	possibly damaging	Het
Ctsf	T	G	19: 4,856,539	F165V	probably damaging	Het
Cyp3a44	T	A	5: 145,801,325	I57L	probably benign	Het
Dbx2	C	T	15: 95,654,318	G149S	probably benign	Het
Dennd2a	A	G	6: 39,480,273	V745A	possibly damaging	Het
Dock10	A	T	1: 80,586,368	S509R	possibly damaging	Het
Enpp3	T	C	10: 24,784,854	Y630C	probably damaging	Het
Eomes	C	T	9: 118,478,506		probably benign	Het
Fchsd1	A	T	18: 37,964,159	V385E	probably damaging	Het
Flg	A	T	3: 93,286,677	H34L	unknown	Het
Frs3	G	T	17: 47,699,538	E32D	possibly damaging	Het
Gm14443	C	T	2: 175,170,242	C137Y	probably benign	Het
Havcr1	T	A	11: 46,752,575	C107*	probably null	Het
Hectd4	C	T	5: 121,310,629	R347W	probably damaging	Het
Hist2h3b	C	A	3: 96,268,993	Y100*	probably null	Het
Hspbp1	A	G	7: 4,681,842		probably null	Het
Irs1	C	T	1: 82,288,722	R591H	possibly damaging	Het
Kif5b	A	G	18: 6,241,040	V23A	probably benign	Het
Myo1e	A	T	9: 70,335,219	I339F	possibly damaging	Het
Nkx2-5	T	C	17: 26,839,176	Y268C	probably damaging	Het
Olfr834	T	C	9: 18,988,656	S223P	probably damaging	Het
Polrmt	T	C	10: 79,738,789	M857V	probably damaging	Het
Prkd3	T	A	17: 79,008,262	M1L	not run	Het
Psmc3	T	A	2: 91,056,662	V202E	possibly damaging	Het
Rab3d	G	A	9: 21,914,933	R93C	probably damaging	Het
Rasgrf2	A	C	13: 92,030,792	Y258D	probably damaging	Het
Rcbtb1	A	C	14: 59,221,567	S199R	probably benign	Het
Rif1	T	G	2: 52,074,276	V45G	probably damaging	Het
Riok3	G	A	18: 12,136,719	G69E	probably benign	Het
Scn1a	A	G	2: 66,328,442	L378P	probably damaging	Het
Sil1	A	T	18: 35,348,666	N113K	probably benign	Het
Slc35c2	C	T	2: 165,277,542	D293N	probably damaging	Het
Slc37a3	A	T	6: 39,347,391	S308T	possibly damaging	Het
Smarca5	A	T	8: 80,736,759	V60E	probably benign	Het
Smok3c	T	A	5: 138,065,079	V276D	probably damaging	Het
Snx29	G	A	16: 11,413,357		probably null	Het
Spata24	T	C	18: 35,662,040	E30G	probably damaging	Het
Stard13	T	A	5: 151,052,373	I777F	probably damaging	Het
Synpo2	A	G	3: 123,235,986	C8R	probably benign	Het
Tmem104	T	C	11: 115,243,481	V281A	probably damaging	Het
Tmprss11a	C	T	5: 86,420,020	G283R	probably damaging	Het
Trpc2	G	A	7: 102,089,181	V457M	probably benign	Het
Usp53	A	T	3: 122,934,351	S861T	possibly damaging	Het
Uty	G	T	Y: 1,154,210	S738*	probably null	Het
Wdr17	C	T	8: 54,660,771		probably null	Het
Wdr7	A	T	18: 63,904,086	S1194C	probably damaging	Het
Zyx	A	C	6: 42,356,571	D477A	probably damaging	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7714:Rassf8	UTSW	6	145815247	missense	probably damaging	0.98
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAAACTGCACCGGGAAGTTC -3'
(R):5'- GCTGATCTGGTCACAAACTTCC -3'

Sequencing Primer
(F):5'- GTTCAGGAGGCACAGGTC -3'
(R):5'- GATCTGGTCACAAACTTCCTTCTTG -3'

Posted On

2020-09-15