Incidental Mutation 'R7962:Hspbp1'
ID650165
Institutional Source Beutler Lab
Gene Symbol Hspbp1
Ensembl Gene ENSMUSG00000063802
Gene NameHSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4660521-4685068 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 4681842 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079970] [ENSMUST00000205952] [ENSMUST00000206306] [ENSMUST00000206946]
Predicted Effect probably null
Transcript: ENSMUST00000079970
SMART Domains Protein: ENSMUSP00000078886
Gene: ENSMUSG00000063802

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
Pfam:Fes1 43 138 2.5e-12 PFAM
SCOP:d1ee4a_ 150 302 2e-12 SMART
Blast:ARM 216 256 3e-11 BLAST
Blast:ARM 259 299 4e-13 BLAST
low complexity region 306 342 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205952
Predicted Effect probably null
Transcript: ENSMUST00000206306
Predicted Effect probably null
Transcript: ENSMUST00000206946
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show male infertility with an arrest of male meiosis, increased male germ cell apoptosis and azoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Hspbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Hspbp1 APN 7 4664751 missense probably damaging 0.97
IGL02072:Hspbp1 APN 7 4677721 missense probably damaging 1.00
IGL02548:Hspbp1 APN 7 4681841 splice site probably benign
IGL02573:Hspbp1 APN 7 4677853 missense probably damaging 1.00
IGL03177:Hspbp1 APN 7 4664701 critical splice donor site probably null
IGL03181:Hspbp1 APN 7 4684364 missense probably damaging 1.00
R0568:Hspbp1 UTSW 7 4684432 nonsense probably null
R0670:Hspbp1 UTSW 7 4677736 missense probably damaging 1.00
R3013:Hspbp1 UTSW 7 4663484 missense probably benign 0.18
R3729:Hspbp1 UTSW 7 4677809 missense probably damaging 1.00
R3934:Hspbp1 UTSW 7 4664595 missense probably benign 0.41
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6031:Hspbp1 UTSW 7 4663466 missense probably benign 0.28
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6034:Hspbp1 UTSW 7 4677712 missense probably damaging 1.00
R6728:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6797:Hspbp1 UTSW 7 4660782 missense possibly damaging 0.93
R6930:Hspbp1 UTSW 7 4684607 missense probably benign
R6992:Hspbp1 UTSW 7 4664715 missense probably benign 0.23
R7459:Hspbp1 UTSW 7 4684578 missense probably benign 0.00
R7525:Hspbp1 UTSW 7 4663436 missense probably damaging 1.00
R7608:Hspbp1 UTSW 7 4660822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GAGTCAACATCAGTCCCAGGAC -3'
(R):5'- TCTTCCCTAGAGACGCCAATGG -3'

Sequencing Primer
(F):5'- CTCCTCGGGAAGTAGCAGAAC -3'
(R):5'- TGCAGGAAGCCATGTCG -3'
Posted On2020-09-15