Incidental Mutation 'R7962:Enpp3'
ID 650176
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R7962 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24660752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 630 (Y630C)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: Y630C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: Y630C

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg6 A G 10: 14,296,428 (GRCm39) F991L probably damaging Het
Ahnak A G 19: 8,990,164 (GRCm39) D3816G unknown Het
Arhgdig T C 17: 26,418,608 (GRCm39) T153A probably damaging Het
Ash2l T C 8: 26,329,792 (GRCm39) D122G probably damaging Het
Bora A G 14: 99,310,162 (GRCm39) K497R probably benign Het
Btbd9 T C 17: 30,736,177 (GRCm39) H312R probably damaging Het
Cbr2 T C 11: 120,620,609 (GRCm39) D225G probably benign Het
Cemip C A 7: 83,652,616 (GRCm39) probably benign Het
Cfap70 G A 14: 20,486,854 (GRCm39) T275M probably benign Het
Clca4b T C 3: 144,622,421 (GRCm39) D548G possibly damaging Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Cyp3a44 T A 5: 145,738,135 (GRCm39) I57L probably benign Het
Dbx2 C T 15: 95,552,199 (GRCm39) G149S probably benign Het
Dennd2a A G 6: 39,457,207 (GRCm39) V745A possibly damaging Het
Dock10 A T 1: 80,564,085 (GRCm39) S509R possibly damaging Het
Eomes C T 9: 118,307,574 (GRCm39) probably benign Het
Fchsd1 A T 18: 38,097,212 (GRCm39) V385E probably damaging Het
Flg A T 3: 93,193,984 (GRCm39) H34L unknown Het
Frs3 G T 17: 48,010,463 (GRCm39) E32D possibly damaging Het
Gm14443 C T 2: 175,012,035 (GRCm39) C137Y probably benign Het
H3c13 C A 3: 96,176,309 (GRCm39) Y100* probably null Het
Havcr1 T A 11: 46,643,402 (GRCm39) C107* probably null Het
Hectd4 C T 5: 121,448,692 (GRCm39) R347W probably damaging Het
Hspbp1 A G 7: 4,684,841 (GRCm39) probably null Het
Irs1 C T 1: 82,266,443 (GRCm39) R591H possibly damaging Het
Kif5b A G 18: 6,241,040 (GRCm39) V23A probably benign Het
Myo1e A T 9: 70,242,501 (GRCm39) I339F possibly damaging Het
Nkx2-5 T C 17: 27,058,150 (GRCm39) Y268C probably damaging Het
Or7g12 T C 9: 18,899,952 (GRCm39) S223P probably damaging Het
Polrmt T C 10: 79,574,623 (GRCm39) M857V probably damaging Het
Prkd3 T A 17: 79,315,691 (GRCm39) M1L not run Het
Prss3b A C 6: 41,012,387 (GRCm39) F9C probably benign Het
Psmc3 T A 2: 90,887,007 (GRCm39) V202E possibly damaging Het
Rab3d G A 9: 21,826,229 (GRCm39) R93C probably damaging Het
Rasgrf2 A C 13: 92,167,300 (GRCm39) Y258D probably damaging Het
Rassf8 G A 6: 145,761,669 (GRCm39) probably null Het
Rcbtb1 A C 14: 59,459,016 (GRCm39) S199R probably benign Het
Rif1 T G 2: 51,964,288 (GRCm39) V45G probably damaging Het
Riok3 G A 18: 12,269,776 (GRCm39) G69E probably benign Het
Scn1a A G 2: 66,158,786 (GRCm39) L378P probably damaging Het
Sil1 A T 18: 35,481,719 (GRCm39) N113K probably benign Het
Slc35c2 C T 2: 165,119,462 (GRCm39) D293N probably damaging Het
Slc37a3 A T 6: 39,324,325 (GRCm39) S308T possibly damaging Het
Smarca5 A T 8: 81,463,388 (GRCm39) V60E probably benign Het
Smok3c T A 5: 138,063,341 (GRCm39) V276D probably damaging Het
Snx29 G A 16: 11,231,221 (GRCm39) probably null Het
Spata24 T C 18: 35,795,093 (GRCm39) E30G probably damaging Het
Stard13 T A 5: 150,975,838 (GRCm39) I777F probably damaging Het
Synpo2 A G 3: 123,029,635 (GRCm39) C8R probably benign Het
Tmem104 T C 11: 115,134,307 (GRCm39) V281A probably damaging Het
Tmprss11a C T 5: 86,567,879 (GRCm39) G283R probably damaging Het
Trpc2 G A 7: 101,738,388 (GRCm39) V457M probably benign Het
Usp53 A T 3: 122,728,000 (GRCm39) S861T possibly damaging Het
Uty G T Y: 1,154,210 (GRCm39) S738* probably null Het
Wdr17 C T 8: 55,113,806 (GRCm39) probably null Het
Wdr7 A T 18: 64,037,157 (GRCm39) S1194C probably damaging Het
Zyx A C 6: 42,333,505 (GRCm39) D477A probably damaging Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGTCCACCCTCACTTTG -3'
(R):5'- ATCTTTGCTTAGCACCTGGG -3'

Sequencing Primer
(F):5'- ACTTTGGGAAGCCTTCAGC -3'
(R):5'- AATAACCTATCTCCCAGGGTTGTTG -3'
Posted On 2020-09-15