Incidental Mutation 'R7962:Tmem104'
ID650179
Institutional Source Beutler Lab
Gene Symbol Tmem104
Ensembl Gene ENSMUSG00000045980
Gene Nametransmembrane protein 104
SynonymsC630005D06Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115187487-115247023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115243481 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 281 (V281A)
Ref Sequence ENSEMBL: ENSMUSP00000056805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061450] [ENSMUST00000100235]
Predicted Effect probably damaging
Transcript: ENSMUST00000061450
AA Change: V281A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056805
Gene: ENSMUSG00000045980
AA Change: V281A

DomainStartEndE-ValueType
Pfam:Aa_trans 13 77 3.4e-10 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 128 487 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100235
AA Change: V280A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097807
Gene: ENSMUSG00000045980
AA Change: V280A

DomainStartEndE-ValueType
Pfam:Aa_trans 13 81 5.5e-11 PFAM
low complexity region 84 100 N/A INTRINSIC
Pfam:Aa_trans 127 485 1.2e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Tmem104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tmem104 APN 11 115243937 missense probably damaging 1.00
IGL02948:Tmem104 APN 11 115197296 missense probably damaging 1.00
IGL03010:Tmem104 APN 11 115243534 missense probably benign 0.01
R0107:Tmem104 UTSW 11 115202180 missense probably damaging 1.00
R0399:Tmem104 UTSW 11 115201308 splice site probably benign
R0534:Tmem104 UTSW 11 115200828 missense probably damaging 1.00
R2034:Tmem104 UTSW 11 115243547 missense probably benign 0.42
R2037:Tmem104 UTSW 11 115201395 missense possibly damaging 0.95
R4095:Tmem104 UTSW 11 115243923 nonsense probably null
R4640:Tmem104 UTSW 11 115243724 missense probably damaging 1.00
R4981:Tmem104 UTSW 11 115205136 missense probably damaging 1.00
R5011:Tmem104 UTSW 11 115243486 missense probably damaging 1.00
R5086:Tmem104 UTSW 11 115201401 missense probably damaging 0.98
R5522:Tmem104 UTSW 11 115188323 critical splice donor site probably null
R5602:Tmem104 UTSW 11 115205124 missense probably damaging 1.00
R6025:Tmem104 UTSW 11 115205523 nonsense probably null
R6247:Tmem104 UTSW 11 115243993 missense probably benign
R6522:Tmem104 UTSW 11 115243753 missense probably damaging 1.00
R7980:Tmem104 UTSW 11 115243754 missense probably damaging 1.00
R8323:Tmem104 UTSW 11 115243373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCATAGGCTCAGCAGC -3'
(R):5'- TGTACATGTCCATGAGGCTGTC -3'

Sequencing Primer
(F):5'- GCTCAGTAGCCCCACATG -3'
(R):5'- TGTCCCCACGGAAGCAGAAG -3'
Posted On2020-09-15