Incidental Mutation 'R7962:Bora'
ID650184
Institutional Source Beutler Lab
Gene Symbol Bora
Ensembl Gene ENSMUSG00000022070
Gene Namebora, aurora kinase A activator
Synonyms6720463M24Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location99046222-99074540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99072726 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 497 (K497R)
Ref Sequence ENSEMBL: ENSMUSP00000022656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022656] [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000227744] [ENSMUST00000228643]
Predicted Effect probably benign
Transcript: ENSMUST00000022656
AA Change: K497R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000022656
Gene: ENSMUSG00000022070
AA Change: K497R

DomainStartEndE-ValueType
Pfam:BORA_N 7 207 2.4e-69 PFAM
low complexity region 392 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042471
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227022
Predicted Effect probably benign
Transcript: ENSMUST00000227744
Predicted Effect probably benign
Transcript: ENSMUST00000228643
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BORA is an activator of the protein kinase Aurora A (AURKA; MIM 603072), which is required for centrosome maturation, spindle assembly, and asymmetric protein localization during mitosis (Hutterer et al., 2006 [PubMed 16890155]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Bora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02111:Bora APN 14 99047377 missense probably damaging 1.00
IGL02119:Bora APN 14 99053538 missense probably damaging 1.00
IGL02129:Bora APN 14 99056821 critical splice donor site probably null
IGL02171:Bora APN 14 99047322 missense probably damaging 1.00
IGL03338:Bora APN 14 99072742 missense probably damaging 1.00
R0504:Bora UTSW 14 99061623 nonsense probably null
R1598:Bora UTSW 14 99068404 missense probably benign
R2070:Bora UTSW 14 99062278 missense probably damaging 1.00
R2071:Bora UTSW 14 99062278 missense probably damaging 1.00
R4521:Bora UTSW 14 99068548 missense probably damaging 0.99
R4861:Bora UTSW 14 99047474 splice site probably null
R4881:Bora UTSW 14 99061567 missense probably damaging 1.00
R4982:Bora UTSW 14 99047352 missense probably damaging 1.00
R5341:Bora UTSW 14 99068094 missense probably damaging 1.00
R5378:Bora UTSW 14 99068493 missense probably damaging 1.00
R5913:Bora UTSW 14 99068512 missense probably benign 0.02
R6082:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6083:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6084:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6085:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6086:Bora UTSW 14 99062294 missense possibly damaging 0.88
R6269:Bora UTSW 14 99073667 missense probably damaging 0.99
R7354:Bora UTSW 14 99047358 missense probably damaging 1.00
R7794:Bora UTSW 14 99072644 missense possibly damaging 0.50
R8299:Bora UTSW 14 99068134 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCCTTGCGGGAAATGTTTCG -3'
(R):5'- AGCTATTTGAAATGTTTCCAGGAGAGC -3'

Sequencing Primer
(F):5'- CCTTGCGGGAAATGTTTCGTAAAG -3'
(R):5'- CAGGAGAGCAAAGTTTCTGCCTTTC -3'
Posted On2020-09-15