Incidental Mutation 'R7962:Riok3'
ID650193
Institutional Source Beutler Lab
Gene Symbol Riok3
Ensembl Gene ENSMUSG00000024404
Gene NameRIO kinase 3
SynonymsSudd, 1200013N13Rik, E130306C24Rik, D18Ertd331e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12128850-12157367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12136719 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 69 (G69E)
Ref Sequence ENSEMBL: ENSMUSP00000025270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025270]
Predicted Effect probably benign
Transcript: ENSMUST00000025270
AA Change: G69E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025270
Gene: ENSMUSG00000024404
AA Change: G69E

DomainStartEndE-ValueType
low complexity region 41 63 N/A INTRINSIC
low complexity region 123 131 N/A INTRINSIC
RIO 222 470 9.88e-141 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first identified by the similarity of its product to the Aspergillus nidulans SUDD protein. This gene is now recognized as a member of the right open reading frame (RIO) kinase gene family. This gene encodes a serine/threonine kinase that localizes to the cytoplasm and plays a role in the processing of the pre-40 S ribosomal subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Riok3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Riok3 APN 18 12148891 missense possibly damaging 0.81
IGL00229:Riok3 APN 18 12137020 missense probably damaging 1.00
IGL00434:Riok3 APN 18 12148847 missense probably damaging 1.00
IGL01348:Riok3 APN 18 12152963 splice site probably benign
IGL01886:Riok3 APN 18 12139385 missense probably damaging 1.00
IGL02553:Riok3 APN 18 12143016 nonsense probably null
IGL02622:Riok3 APN 18 12142960 missense probably benign 0.24
IGL02718:Riok3 APN 18 12152996 nonsense probably null
LCD18:Riok3 UTSW 18 12129982 intron probably benign
R0240:Riok3 UTSW 18 12155227 missense probably benign 0.37
R0359:Riok3 UTSW 18 12148949 missense probably damaging 1.00
R1505:Riok3 UTSW 18 12152878 missense probably benign 0.06
R1519:Riok3 UTSW 18 12137306 missense probably damaging 1.00
R1698:Riok3 UTSW 18 12128929 missense probably benign 0.02
R1710:Riok3 UTSW 18 12142961 missense probably benign 0.24
R1965:Riok3 UTSW 18 12136962 missense probably damaging 0.99
R2351:Riok3 UTSW 18 12149667 nonsense probably null
R3705:Riok3 UTSW 18 12148954 missense probably benign 0.07
R3914:Riok3 UTSW 18 12148822 missense probably benign
R3956:Riok3 UTSW 18 12142974 nonsense probably null
R4272:Riok3 UTSW 18 12135941 small deletion probably benign
R4273:Riok3 UTSW 18 12135941 small deletion probably benign
R4564:Riok3 UTSW 18 12148879 missense probably damaging 0.99
R4589:Riok3 UTSW 18 12136787 missense probably benign 0.06
R4729:Riok3 UTSW 18 12128927 missense possibly damaging 0.82
R4751:Riok3 UTSW 18 12153983 missense probably benign 0.00
R4938:Riok3 UTSW 18 12155243 missense probably benign 0.06
R4945:Riok3 UTSW 18 12128915 missense probably damaging 0.96
R5449:Riok3 UTSW 18 12155246 missense probably damaging 0.97
R5928:Riok3 UTSW 18 12153018 missense probably benign 0.16
R6220:Riok3 UTSW 18 12149551 missense probably damaging 0.97
R8422:Riok3 UTSW 18 12136812 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCAATCCTAGCTGCAGC -3'
(R):5'- AGGAGTGTACACAGGCATTTCC -3'

Sequencing Primer
(F):5'- TGCAGCTCTCAGAGTTGGC -3'
(R):5'- GTGTACACAGGCATTTCCTACCAC -3'
Posted On2020-09-15