Incidental Mutation 'R7962:Ctsf'
ID650198
Institutional Source Beutler Lab
Gene Symbol Ctsf
Ensembl Gene ENSMUSG00000083282
Gene Namecathepsin F
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7962 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location4855129-4860912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4856539 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 165 (F165V)
Ref Sequence ENSEMBL: ENSMUSP00000112481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Meta Mutation Damage Score 0.8977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik A C 6: 41,035,453 F9C probably benign Het
Adgrg6 A G 10: 14,420,684 F991L probably damaging Het
Ahnak A G 19: 9,012,800 D3816G unknown Het
Arhgdig T C 17: 26,199,634 T153A probably damaging Het
Ash2l T C 8: 25,839,764 D122G probably damaging Het
Bora A G 14: 99,072,726 K497R probably benign Het
Btbd9 T C 17: 30,517,203 H312R probably damaging Het
Cbr2 T C 11: 120,729,783 D225G probably benign Het
Cemip C A 7: 84,003,408 probably benign Het
Cfap70 G A 14: 20,436,786 T275M probably benign Het
Clca4b T C 3: 144,916,660 D548G possibly damaging Het
Cyp3a44 T A 5: 145,801,325 I57L probably benign Het
Dbx2 C T 15: 95,654,318 G149S probably benign Het
Dennd2a A G 6: 39,480,273 V745A possibly damaging Het
Dock10 A T 1: 80,586,368 S509R possibly damaging Het
Enpp3 T C 10: 24,784,854 Y630C probably damaging Het
Eomes C T 9: 118,478,506 probably benign Het
Fchsd1 A T 18: 37,964,159 V385E probably damaging Het
Flg A T 3: 93,286,677 H34L unknown Het
Frs3 G T 17: 47,699,538 E32D possibly damaging Het
Gm14443 C T 2: 175,170,242 C137Y probably benign Het
Havcr1 T A 11: 46,752,575 C107* probably null Het
Hectd4 C T 5: 121,310,629 R347W probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hspbp1 A G 7: 4,681,842 probably null Het
Irs1 C T 1: 82,288,722 R591H possibly damaging Het
Kif5b A G 18: 6,241,040 V23A probably benign Het
Myo1e A T 9: 70,335,219 I339F possibly damaging Het
Nkx2-5 T C 17: 26,839,176 Y268C probably damaging Het
Olfr834 T C 9: 18,988,656 S223P probably damaging Het
Polrmt T C 10: 79,738,789 M857V probably damaging Het
Prkd3 T A 17: 79,008,262 M1L not run Het
Psmc3 T A 2: 91,056,662 V202E possibly damaging Het
Rab3d G A 9: 21,914,933 R93C probably damaging Het
Rasgrf2 A C 13: 92,030,792 Y258D probably damaging Het
Rassf8 G A 6: 145,815,943 probably null Het
Rcbtb1 A C 14: 59,221,567 S199R probably benign Het
Rif1 T G 2: 52,074,276 V45G probably damaging Het
Riok3 G A 18: 12,136,719 G69E probably benign Het
Scn1a A G 2: 66,328,442 L378P probably damaging Het
Sil1 A T 18: 35,348,666 N113K probably benign Het
Slc35c2 C T 2: 165,277,542 D293N probably damaging Het
Slc37a3 A T 6: 39,347,391 S308T possibly damaging Het
Smarca5 A T 8: 80,736,759 V60E probably benign Het
Smok3c T A 5: 138,065,079 V276D probably damaging Het
Snx29 G A 16: 11,413,357 probably null Het
Spata24 T C 18: 35,662,040 E30G probably damaging Het
Stard13 T A 5: 151,052,373 I777F probably damaging Het
Synpo2 A G 3: 123,235,986 C8R probably benign Het
Tmem104 T C 11: 115,243,481 V281A probably damaging Het
Tmprss11a C T 5: 86,420,020 G283R probably damaging Het
Trpc2 G A 7: 102,089,181 V457M probably benign Het
Usp53 A T 3: 122,934,351 S861T possibly damaging Het
Uty G T Y: 1,154,210 S738* probably null Het
Wdr17 C T 8: 54,660,771 probably null Het
Wdr7 A T 18: 63,904,086 S1194C probably damaging Het
Zyx A C 6: 42,356,571 D477A probably damaging Het
Other mutations in Ctsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ctsf APN 19 4858078 missense probably damaging 1.00
IGL01891:Ctsf APN 19 4856567 missense probably damaging 0.99
IGL03291:Ctsf APN 19 4859634 missense probably benign 0.00
R0587:Ctsf UTSW 19 4855738 missense probably benign 0.35
R0831:Ctsf UTSW 19 4859840 missense possibly damaging 0.92
R1808:Ctsf UTSW 19 4856534 missense probably benign 0.00
R5652:Ctsf UTSW 19 4858477 missense probably damaging 1.00
R5662:Ctsf UTSW 19 4856578 missense probably damaging 0.98
R6993:Ctsf UTSW 19 4858483 missense probably benign 0.45
R7702:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7703:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7704:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7705:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7965:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7966:Ctsf UTSW 19 4856539 missense probably damaging 1.00
RF012:Ctsf UTSW 19 4858666 missense probably benign 0.05
Z1176:Ctsf UTSW 19 4856306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGAGACAAAGGCCCCTTAATC -3'
(R):5'- CTCCTTGAGAGACACAGGATCC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'
Posted On2020-09-15