Incidental Mutation 'R7963:Ctsr'
ID650234
Institutional Source Beutler Lab
Gene Symbol Ctsr
Ensembl Gene ENSMUSG00000055679
Gene Namecathepsin R
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location61159204-61164256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 61162462 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 127 (V127L)
Ref Sequence ENSEMBL: ENSMUSP00000021889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021889]
Predicted Effect probably damaging
Transcript: ENSMUST00000021889
AA Change: V127L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021889
Gene: ENSMUSG00000055679
AA Change: V127L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Inhibitor_I29 29 88 1.68e-21 SMART
Pept_C1 115 333 1.59e-111 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,192,554 K101E probably benign Het
4930407I10Rik A G 15: 82,063,936 K678R possibly damaging Het
Akr1b10 G C 6: 34,387,708 A35P possibly damaging Het
Arhgef10l T C 4: 140,579,425 E106G probably damaging Het
Atp9a T C 2: 168,674,812 Y445C probably damaging Het
Btbd18 T C 2: 84,667,895 S626P probably benign Het
Cdh23 A T 10: 60,336,188 N1738K probably damaging Het
Cdv3 T C 9: 103,364,011 D119G probably damaging Het
Cep295 A G 9: 15,333,441 F1240L possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dlg1 G A 16: 31,790,301 R271Q probably null Het
Dnajc1 G A 2: 18,222,724 T377I possibly damaging Het
F2rl3 T C 8: 72,762,705 Y187H probably damaging Het
Fgf1 A T 18: 38,847,114 V69E probably damaging Het
Garem1 T C 18: 21,148,787 K171E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Il2ra G A 2: 11,674,424 R65H probably benign Het
Lrp1b T C 2: 40,927,935 I2428V Het
Lrp3 G A 7: 35,202,979 Q579* probably null Het
Lrrc6 A T 15: 66,380,517 D433E probably damaging Het
Ncoa6 G A 2: 155,405,996 T1796I probably benign Het
Ncor1 T C 11: 62,334,533 I747V probably benign Het
Nfkb2 C T 19: 46,309,919 T554M possibly damaging Het
Nrde2 T C 12: 100,149,868 D119G probably damaging Het
Odf2 C A 2: 29,926,100 Q720K probably benign Het
Olfr1080 T C 2: 86,553,295 I276M possibly damaging Het
Olfr1133 C T 2: 87,645,425 E233K probably benign Het
Olfr1263 T C 2: 90,015,659 V243A possibly damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Pcx T C 19: 4,602,006 V94A probably damaging Het
Pdxdc1 A T 16: 13,876,166 Y131N possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plod2 A G 9: 92,605,446 H606R probably benign Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Rsl1 A G 13: 67,182,109 E207G probably damaging Het
Slc28a3 A G 13: 58,576,766 Y225H probably damaging Het
Spag17 T A 3: 100,022,638 M551K probably benign Het
Ssh2 C A 11: 77,421,356 A231D possibly damaging Het
Stab2 A G 10: 86,848,023 probably null Het
Stac2 T C 11: 98,041,577 T197A probably benign Het
Syne2 T A 12: 76,020,400 L4291Q probably benign Het
Vmn2r38 A T 7: 9,092,855 D179E probably benign Het
Zfp597 T C 16: 3,871,158 D51G probably benign Het
Zfp64 A T 2: 168,951,618 F69L probably benign Het
Other mutations in Ctsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Ctsr APN 13 61162742 missense probably damaging 1.00
IGL01327:Ctsr APN 13 61162675 splice site probably benign
IGL02169:Ctsr APN 13 61163240 splice site probably benign
IGL02516:Ctsr APN 13 61163178 missense probably benign
IGL02739:Ctsr APN 13 61161844 missense probably benign 0.01
PIT4687001:Ctsr UTSW 13 61160532 missense possibly damaging 0.52
R0180:Ctsr UTSW 13 61162745 missense probably damaging 1.00
R1938:Ctsr UTSW 13 61162445 missense probably benign 0.00
R2362:Ctsr UTSW 13 61162796 missense probably damaging 1.00
R3856:Ctsr UTSW 13 61161936 missense possibly damaging 0.75
R4125:Ctsr UTSW 13 61161845 missense probably benign 0.17
R4135:Ctsr UTSW 13 61161270 missense probably benign 0.15
R4903:Ctsr UTSW 13 61163131 missense probably benign 0.01
R5551:Ctsr UTSW 13 61159543 missense probably damaging 1.00
R5705:Ctsr UTSW 13 61161264 missense probably damaging 1.00
R5721:Ctsr UTSW 13 61161853 missense possibly damaging 0.84
R6132:Ctsr UTSW 13 61161768 critical splice donor site probably null
R6196:Ctsr UTSW 13 61160531 missense probably benign 0.09
R6719:Ctsr UTSW 13 61160451 missense possibly damaging 0.60
R7530:Ctsr UTSW 13 61163117 missense probably damaging 1.00
R7698:Ctsr UTSW 13 61162567 missense probably benign 0.01
R8251:Ctsr UTSW 13 61162778 missense probably damaging 1.00
R8431:Ctsr UTSW 13 61160490 missense probably damaging 1.00
R8810:Ctsr UTSW 13 61161825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGATTCCTTGGAGATATCAGAC -3'
(R):5'- GATTGCTTCACACTGTGCTC -3'

Sequencing Primer
(F):5'- GCTCTAGTCATGGCCATATACATG -3'
(R):5'- GCTCTCATTAGTACTTTATAAGGTGG -3'
Posted On2020-09-15