Incidental Mutation 'R7963:Zfp597'
ID650239
Institutional Source Beutler Lab
Gene Symbol Zfp597
Ensembl Gene ENSMUSG00000039789
Gene Namezinc finger protein 597
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7963 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location3858321-3884561 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3871158 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000088009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090522] [ENSMUST00000151988]
Predicted Effect probably benign
Transcript: ENSMUST00000090522
AA Change: D51G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000088009
Gene: ENSMUSG00000039789
AA Change: D51G

DomainStartEndE-ValueType
KRAB 14 75 2.61e-4 SMART
ZnF_C2H2 155 177 5.21e-4 SMART
ZnF_C2H2 183 205 6.88e-4 SMART
ZnF_C2H2 211 233 1.2e-3 SMART
ZnF_C2H2 239 261 2.4e-3 SMART
ZnF_C2H2 336 358 2.17e-1 SMART
ZnF_C2H2 364 386 1.33e-1 SMART
ZnF_C2H2 392 414 2.75e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151988
SMART Domains Protein: ENSMUSP00000118782
Gene: ENSMUSG00000005982

DomainStartEndE-ValueType
Pfam:Acetyltransf_7 50 157 1.1e-11 PFAM
Pfam:Acetyltransf_1 57 156 1.3e-15 PFAM
Pfam:FR47 77 164 1.6e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple zinc finger domains. Loss of the related gene in rodents results in defects in neural development and embryonic lethality in mutant homozygotes. This gene is adjacent to a differentially methylated region (DMR) and is imprinted and maternally expressed. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,192,554 K101E probably benign Het
4930407I10Rik A G 15: 82,063,936 K678R possibly damaging Het
Akr1b10 G C 6: 34,387,708 A35P possibly damaging Het
Arhgef10l T C 4: 140,579,425 E106G probably damaging Het
Atp9a T C 2: 168,674,812 Y445C probably damaging Het
Btbd18 T C 2: 84,667,895 S626P probably benign Het
Cdh23 A T 10: 60,336,188 N1738K probably damaging Het
Cdv3 T C 9: 103,364,011 D119G probably damaging Het
Cep295 A G 9: 15,333,441 F1240L possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Ctsr C A 13: 61,162,462 V127L probably damaging Het
Dlg1 G A 16: 31,790,301 R271Q probably null Het
Dnajc1 G A 2: 18,222,724 T377I possibly damaging Het
F2rl3 T C 8: 72,762,705 Y187H probably damaging Het
Fgf1 A T 18: 38,847,114 V69E probably damaging Het
Garem1 T C 18: 21,148,787 K171E probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Il2ra G A 2: 11,674,424 R65H probably benign Het
Lrp1b T C 2: 40,927,935 I2428V Het
Lrp3 G A 7: 35,202,979 Q579* probably null Het
Lrrc6 A T 15: 66,380,517 D433E probably damaging Het
Ncoa6 G A 2: 155,405,996 T1796I probably benign Het
Ncor1 T C 11: 62,334,533 I747V probably benign Het
Nfkb2 C T 19: 46,309,919 T554M possibly damaging Het
Nrde2 T C 12: 100,149,868 D119G probably damaging Het
Odf2 C A 2: 29,926,100 Q720K probably benign Het
Olfr1080 T C 2: 86,553,295 I276M possibly damaging Het
Olfr1133 C T 2: 87,645,425 E233K probably benign Het
Olfr1263 T C 2: 90,015,659 V243A possibly damaging Het
Olfr1287 T A 2: 111,449,626 L162Q possibly damaging Het
Pcx T C 19: 4,602,006 V94A probably damaging Het
Pdxdc1 A T 16: 13,876,166 Y131N possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Plod2 A G 9: 92,605,446 H606R probably benign Het
Ptp4a2 A G 4: 129,839,444 probably benign Het
Rsl1 A G 13: 67,182,109 E207G probably damaging Het
Slc28a3 A G 13: 58,576,766 Y225H probably damaging Het
Spag17 T A 3: 100,022,638 M551K probably benign Het
Ssh2 C A 11: 77,421,356 A231D possibly damaging Het
Stab2 A G 10: 86,848,023 probably null Het
Stac2 T C 11: 98,041,577 T197A probably benign Het
Syne2 T A 12: 76,020,400 L4291Q probably benign Het
Vmn2r38 A T 7: 9,092,855 D179E probably benign Het
Zfp64 A T 2: 168,951,618 F69L probably benign Het
Other mutations in Zfp597
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Zfp597 APN 16 3865941 missense probably benign 0.27
IGL02972:Zfp597 APN 16 3866523 missense probably benign 0.20
IGL03289:Zfp597 APN 16 3865922 missense possibly damaging 0.95
R0336:Zfp597 UTSW 16 3866379 missense probably benign 0.15
R0621:Zfp597 UTSW 16 3866364 missense probably benign 0.01
R4270:Zfp597 UTSW 16 3872090 start codon destroyed probably null 1.00
R4361:Zfp597 UTSW 16 3865900 missense probably damaging 1.00
R4774:Zfp597 UTSW 16 3865987 missense probably benign 0.04
R5033:Zfp597 UTSW 16 3866638 missense probably damaging 1.00
R5128:Zfp597 UTSW 16 3872124 unclassified probably benign
R5786:Zfp597 UTSW 16 3866159 nonsense probably null
R5940:Zfp597 UTSW 16 3865821 missense probably damaging 0.99
R7007:Zfp597 UTSW 16 3865927 missense probably benign 0.25
R7008:Zfp597 UTSW 16 3865767 missense probably benign
R7392:Zfp597 UTSW 16 3866505 missense probably benign 0.00
R7976:Zfp597 UTSW 16 3866511 missense possibly damaging 0.82
Z1176:Zfp597 UTSW 16 3866129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACACAAGGGAAAACATTATC -3'
(R):5'- AGGACACTCAACTGACCTGC -3'

Sequencing Primer
(F):5'- GGGAAAACATTATCTGACTCTGACAC -3'
(R):5'- AACTGACCTGCTAGCTTTTTATAC -3'
Posted On2020-09-15