Incidental Mutation 'R7964:Psg21'
ID 650264
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific beta-1-glycoprotein 21
Synonyms 1600019C01Rik, 1600026N13Rik, 1600025N01Rik, cea8
MMRRC Submission 046007-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7964 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18380661-18390650 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18381136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 469 (M469T)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: M469T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: M469T

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,266,146 (GRCm39) M3042L probably benign Het
Abca3 T A 17: 24,621,410 (GRCm39) L1345Q probably benign Het
Adam20 G T 8: 41,249,944 (GRCm39) V685F probably damaging Het
Adam25 T A 8: 41,208,576 (GRCm39) I614N probably damaging Het
Aldh1a7 C T 19: 20,677,371 (GRCm39) V417M probably damaging Het
Aldh1a7 C T 19: 20,693,406 (GRCm39) G171D probably benign Het
Aloxe3 T C 11: 69,017,362 (GRCm39) F45S probably damaging Het
Ankrd26 T C 6: 118,500,160 (GRCm39) I1104V probably benign Het
Ap3d1 C A 10: 80,565,891 (GRCm39) R92L probably damaging Het
Aspm A G 1: 139,408,424 (GRCm39) Q2437R probably damaging Het
Bcl11a T C 11: 24,113,353 (GRCm39) I232T probably benign Het
Cdcp3 G T 7: 130,899,963 (GRCm39) R2102L unknown Het
Cemip2 T C 19: 21,775,794 (GRCm39) probably null Het
Cfap97 A G 8: 46,623,237 (GRCm39) D209G possibly damaging Het
Csmd2 A G 4: 128,417,303 (GRCm39) M2754V Het
Dcdc2c A G 12: 28,520,318 (GRCm39) I586T Het
Dkk4 T C 8: 23,115,368 (GRCm39) C73R probably damaging Het
Dnai3 T C 3: 145,774,531 (GRCm39) N439D probably benign Het
Dzip3 T C 16: 48,772,268 (GRCm39) D467G probably damaging Het
Eif5 T C 12: 111,506,608 (GRCm39) F67L probably benign Het
Elmod1 A G 9: 53,838,860 (GRCm39) I100T probably benign Het
Gm9837 A G 11: 53,361,001 (GRCm39) L71P unknown Het
Hpse A G 5: 100,846,777 (GRCm39) probably null Het
Insc T C 7: 114,445,708 (GRCm39) L472P probably damaging Het
Itgax A C 7: 127,739,590 (GRCm39) probably null Het
Lair1 A G 7: 4,013,803 (GRCm39) V148A probably benign Het
Lama2 A G 10: 27,099,977 (GRCm39) probably null Het
Ldlrad1 G A 4: 107,066,688 (GRCm39) A8T probably benign Het
Lgr5 T C 10: 115,288,079 (GRCm39) D855G probably benign Het
Lrp1 C A 10: 127,410,913 (GRCm39) R1425L possibly damaging Het
Lrp1b A G 2: 40,488,523 (GRCm39) S4521P Het
Nbas A G 12: 13,406,896 (GRCm39) Y831C probably damaging Het
Nek9 C A 12: 85,385,787 (GRCm39) R70L probably benign Het
Nlrp2 A C 7: 5,331,527 (GRCm39) L290V probably damaging Het
Nos1 T A 5: 118,038,607 (GRCm39) I480N probably damaging Het
Or4a80 T C 2: 89,583,158 (GRCm39) N5D possibly damaging Het
Pcdhb13 C A 18: 37,577,871 (GRCm39) Q750K possibly damaging Het
Pik3c2g C T 6: 139,827,786 (GRCm39) T727I Het
Pik3r6 C A 11: 68,424,565 (GRCm39) P390Q probably benign Het
Pramel1 T C 4: 143,123,810 (GRCm39) S162P probably benign Het
Psg27 A T 7: 18,299,124 (GRCm39) W66R probably damaging Het
Sbno2 A G 10: 79,904,185 (GRCm39) C371R probably damaging Het
Shroom1 G T 11: 53,355,149 (GRCm39) K329N possibly damaging Het
Slc35a3 A G 3: 116,480,984 (GRCm39) I93T possibly damaging Het
Slc38a2 G A 15: 96,590,453 (GRCm39) T297M probably benign Het
Sorl1 T A 9: 41,902,697 (GRCm39) D1620V probably damaging Het
Srsf4 T A 4: 131,618,544 (GRCm39) L45Q probably benign Het
Tcaf2 G A 6: 42,606,640 (GRCm39) S438L probably benign Het
Trappc11 T A 8: 47,979,979 (GRCm39) I186L possibly damaging Het
Usp9y A T Y: 1,316,914 (GRCm39) N1878K probably benign Het
Zfp280d T A 9: 72,229,740 (GRCm39) M349K probably damaging Het
Zgpat A G 2: 181,020,274 (GRCm39) H227R probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18,388,750 (GRCm39) missense probably damaging 1.00
IGL02390:Psg21 APN 7 18,386,556 (GRCm39) missense probably benign 0.11
IGL02548:Psg21 APN 7 18,388,961 (GRCm39) missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18,386,410 (GRCm39) missense probably benign 0.03
IGL03135:Psg21 APN 7 18,388,843 (GRCm39) missense probably benign 0.00
R0131:Psg21 UTSW 7 18,388,793 (GRCm39) missense probably benign 0.39
R0551:Psg21 UTSW 7 18,386,565 (GRCm39) critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18,390,425 (GRCm39) missense probably benign 0.00
R1874:Psg21 UTSW 7 18,384,741 (GRCm39) missense probably benign 0.15
R1993:Psg21 UTSW 7 18,388,695 (GRCm39) missense probably benign 0.04
R2327:Psg21 UTSW 7 18,386,378 (GRCm39) missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18,386,305 (GRCm39) missense probably damaging 1.00
R4422:Psg21 UTSW 7 18,381,257 (GRCm39) missense probably damaging 1.00
R5138:Psg21 UTSW 7 18,390,453 (GRCm39) start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18,388,939 (GRCm39) missense probably damaging 1.00
R5686:Psg21 UTSW 7 18,386,183 (GRCm39) intron probably benign
R6166:Psg21 UTSW 7 18,390,664 (GRCm39) unclassified probably benign
R6177:Psg21 UTSW 7 18,386,279 (GRCm39) missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18,388,926 (GRCm39) missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18,386,270 (GRCm39) missense probably damaging 1.00
R6482:Psg21 UTSW 7 18,388,664 (GRCm39) splice site probably null
R6729:Psg21 UTSW 7 18,386,516 (GRCm39) missense probably damaging 1.00
R6866:Psg21 UTSW 7 18,386,209 (GRCm39) missense probably damaging 1.00
R6992:Psg21 UTSW 7 18,388,668 (GRCm39) critical splice donor site probably null
R7075:Psg21 UTSW 7 18,388,786 (GRCm39) missense probably damaging 1.00
R7081:Psg21 UTSW 7 18,388,774 (GRCm39) nonsense probably null
R7098:Psg21 UTSW 7 18,386,470 (GRCm39) missense probably damaging 1.00
R7582:Psg21 UTSW 7 18,381,128 (GRCm39) makesense probably null
R7588:Psg21 UTSW 7 18,381,134 (GRCm39) missense probably benign 0.00
R7607:Psg21 UTSW 7 18,388,708 (GRCm39) missense probably benign 0.02
R7830:Psg21 UTSW 7 18,381,223 (GRCm39) missense probably damaging 1.00
R8758:Psg21 UTSW 7 18,384,678 (GRCm39) missense probably damaging 1.00
R8972:Psg21 UTSW 7 18,381,293 (GRCm39) missense probably benign 0.03
R8988:Psg21 UTSW 7 18,386,389 (GRCm39) missense probably benign 0.00
R9119:Psg21 UTSW 7 18,381,409 (GRCm39) missense probably benign 0.14
R9446:Psg21 UTSW 7 18,388,865 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCATTGGGCTGCACTGTG -3'
(R):5'- CGTTGGCTCTTCAACAATCAG -3'

Sequencing Primer
(F):5'- ACAGACATTGTGGTACCATATGCTCC -3'
(R):5'- GGCTCTTCAACAATCAGAGTCTG -3'
Posted On 2020-09-15