Incidental Mutation 'R7964:Psg21'
ID 650264
Institutional Source Beutler Lab
Gene Symbol Psg21
Ensembl Gene ENSMUSG00000070796
Gene Name pregnancy-specific glycoprotein 21
Synonyms 1600026N13Rik, 1600019C01Rik, 1600025N01Rik, cea8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.047) question?
Stock # R7964 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18646736-18656725 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18647211 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 469 (M469T)
Ref Sequence ENSEMBL: ENSMUSP00000092387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094793] [ENSMUST00000182128]
AlphaFold Q9DAV5
Predicted Effect probably benign
Transcript: ENSMUST00000094793
AA Change: M469T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000092387
Gene: ENSMUSG00000070796
AA Change: M469T

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
IGc2 393 457 1.47e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182128
SMART Domains Protein: ENSMUSP00000138173
Gene: ENSMUSG00000070796

DomainStartEndE-ValueType
IG 39 138 3.04e-3 SMART
IG 159 260 7.25e-1 SMART
IG 276 375 1.25e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,298,234 R2102L unknown Het
Abca13 A T 11: 9,316,146 M3042L probably benign Het
Abca3 T A 17: 24,402,436 L1345Q probably benign Het
Adam20 G T 8: 40,796,907 V685F probably damaging Het
Adam25 T A 8: 40,755,539 I614N probably damaging Het
Aldh1a7 C T 19: 20,700,007 V417M probably damaging Het
Aldh1a7 C T 19: 20,716,042 G171D probably benign Het
Aloxe3 T C 11: 69,126,536 F45S probably damaging Het
Ankrd26 T C 6: 118,523,199 I1104V probably benign Het
Ap3d1 C A 10: 80,730,057 R92L probably damaging Het
Aspm A G 1: 139,480,686 Q2437R probably damaging Het
Bcl11a T C 11: 24,163,353 I232T probably benign Het
Cfap97 A G 8: 46,170,200 D209G possibly damaging Het
Csmd2 A G 4: 128,523,510 M2754V Het
Dcdc2c A G 12: 28,470,319 I586T Het
Dkk4 T C 8: 22,625,352 C73R probably damaging Het
Dzip3 T C 16: 48,951,905 D467G probably damaging Het
Eif5 T C 12: 111,540,174 F67L probably benign Het
Elmod1 A G 9: 53,931,576 I100T probably benign Het
Gm9837 A G 11: 53,470,174 L71P unknown Het
Hpse A G 5: 100,698,911 probably null Het
Insc T C 7: 114,846,473 L472P probably damaging Het
Itgax A C 7: 128,140,418 probably null Het
Lair1 A G 7: 4,010,804 V148A probably benign Het
Lama2 A G 10: 27,223,981 probably null Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgr5 T C 10: 115,452,174 D855G probably benign Het
Lrp1 C A 10: 127,575,044 R1425L possibly damaging Het
Lrp1b A G 2: 40,598,511 S4521P Het
Nbas A G 12: 13,356,895 Y831C probably damaging Het
Nek9 C A 12: 85,339,013 R70L probably benign Het
Nlrp2 A C 7: 5,328,528 L290V probably damaging Het
Nos1 T A 5: 117,900,542 I480N probably damaging Het
Olfr1253 T C 2: 89,752,814 N5D possibly damaging Het
Pcdhb13 C A 18: 37,444,818 Q750K possibly damaging Het
Pik3c2g C T 6: 139,882,060 T727I Het
Pik3r6 C A 11: 68,533,739 P390Q probably benign Het
Pramel1 T C 4: 143,397,240 S162P probably benign Het
Psg27 A T 7: 18,565,199 W66R probably damaging Het
Sbno2 A G 10: 80,068,351 C371R probably damaging Het
Shroom1 G T 11: 53,464,322 K329N possibly damaging Het
Slc35a3 A G 3: 116,687,335 I93T possibly damaging Het
Slc38a2 G A 15: 96,692,572 T297M probably benign Het
Sorl1 T A 9: 41,991,401 D1620V probably damaging Het
Srsf4 T A 4: 131,891,233 L45Q probably benign Het
Tcaf2 G A 6: 42,629,706 S438L probably benign Het
Tmem2 T C 19: 21,798,430 probably null Het
Trappc11 T A 8: 47,526,944 I186L possibly damaging Het
Usp9y A T Y: 1,316,914 N1878K probably benign Het
Wdr63 T C 3: 146,068,776 N439D probably benign Het
Zfp280d T A 9: 72,322,458 M349K probably damaging Het
Zgpat A G 2: 181,378,481 H227R probably benign Het
Other mutations in Psg21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:Psg21 APN 7 18654825 missense probably damaging 1.00
IGL02390:Psg21 APN 7 18652631 missense probably benign 0.11
IGL02548:Psg21 APN 7 18655036 missense possibly damaging 0.89
IGL03001:Psg21 APN 7 18652485 missense probably benign 0.03
IGL03135:Psg21 APN 7 18654918 missense probably benign 0.00
R0131:Psg21 UTSW 7 18654868 missense probably benign 0.39
R0551:Psg21 UTSW 7 18652640 critical splice acceptor site probably null
R1512:Psg21 UTSW 7 18656500 missense probably benign 0.00
R1874:Psg21 UTSW 7 18650816 missense probably benign 0.15
R1993:Psg21 UTSW 7 18654770 missense probably benign 0.04
R2327:Psg21 UTSW 7 18652453 missense possibly damaging 0.61
R3414:Psg21 UTSW 7 18652380 missense probably damaging 1.00
R4422:Psg21 UTSW 7 18647332 missense probably damaging 1.00
R5138:Psg21 UTSW 7 18656528 start codon destroyed probably null 0.94
R5623:Psg21 UTSW 7 18655014 missense probably damaging 1.00
R5686:Psg21 UTSW 7 18652258 intron probably benign
R6166:Psg21 UTSW 7 18656739 unclassified probably benign
R6177:Psg21 UTSW 7 18652354 missense possibly damaging 0.64
R6190:Psg21 UTSW 7 18655001 missense possibly damaging 0.61
R6210:Psg21 UTSW 7 18652345 missense probably damaging 1.00
R6482:Psg21 UTSW 7 18654739 splice site probably null
R6729:Psg21 UTSW 7 18652591 missense probably damaging 1.00
R6866:Psg21 UTSW 7 18652284 missense probably damaging 1.00
R6992:Psg21 UTSW 7 18654743 critical splice donor site probably null
R7075:Psg21 UTSW 7 18654861 missense probably damaging 1.00
R7081:Psg21 UTSW 7 18654849 nonsense probably null
R7098:Psg21 UTSW 7 18652545 missense probably damaging 1.00
R7582:Psg21 UTSW 7 18647203 makesense probably null
R7588:Psg21 UTSW 7 18647209 missense probably benign 0.00
R7607:Psg21 UTSW 7 18654783 missense probably benign 0.02
R7830:Psg21 UTSW 7 18647298 missense probably damaging 1.00
R8758:Psg21 UTSW 7 18650753 missense probably damaging 1.00
R8972:Psg21 UTSW 7 18647368 missense probably benign 0.03
R8988:Psg21 UTSW 7 18652464 missense probably benign 0.00
R9119:Psg21 UTSW 7 18647484 missense probably benign 0.14
R9446:Psg21 UTSW 7 18654940 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCATTGGGCTGCACTGTG -3'
(R):5'- CGTTGGCTCTTCAACAATCAG -3'

Sequencing Primer
(F):5'- ACAGACATTGTGGTACCATATGCTCC -3'
(R):5'- GGCTCTTCAACAATCAGAGTCTG -3'
Posted On 2020-09-15