Incidental Mutation 'R7964:Ap3d1'
ID650278
Institutional Source Beutler Lab
Gene Symbol Ap3d1
Ensembl Gene ENSMUSG00000020198
Gene Nameadaptor-related protein complex 3, delta 1 subunit
SynonymsmBLVR1, Bolvr
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R7964 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80706956-80742264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80730057 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 92 (R92L)
Ref Sequence ENSEMBL: ENSMUSP00000020420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020420]
Predicted Effect probably damaging
Transcript: ENSMUST00000020420
AA Change: R92L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: R92L

DomainStartEndE-ValueType
Pfam:Adaptin_N 32 583 6.6e-153 PFAM
Pfam:Cnd1 130 292 2.1e-8 PFAM
low complexity region 629 642 N/A INTRINSIC
BLVR 660 803 5.3e-80 SMART
low complexity region 835 861 N/A INTRINSIC
low complexity region 871 881 N/A INTRINSIC
coiled coil region 910 933 N/A INTRINSIC
low complexity region 947 964 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,298,234 R2102L unknown Het
Abca13 A T 11: 9,316,146 M3042L probably benign Het
Abca3 T A 17: 24,402,436 L1345Q probably benign Het
Adam20 G T 8: 40,796,907 V685F probably damaging Het
Adam25 T A 8: 40,755,539 I614N probably damaging Het
Aldh1a7 C T 19: 20,700,007 V417M probably damaging Het
Aldh1a7 C T 19: 20,716,042 G171D probably benign Het
Aloxe3 T C 11: 69,126,536 F45S probably damaging Het
Ankrd26 T C 6: 118,523,199 I1104V probably benign Het
Aspm A G 1: 139,480,686 Q2437R probably damaging Het
Bcl11a T C 11: 24,163,353 I232T probably benign Het
Cfap97 A G 8: 46,170,200 D209G possibly damaging Het
Csmd2 A G 4: 128,523,510 M2754V Het
Dcdc2c A G 12: 28,470,319 I586T Het
Dkk4 T C 8: 22,625,352 C73R probably damaging Het
Dzip3 T C 16: 48,951,905 D467G probably damaging Het
Eif5 T C 12: 111,540,174 F67L probably benign Het
Elmod1 A G 9: 53,931,576 I100T probably benign Het
Gm9837 A G 11: 53,470,174 L71P unknown Het
Hpse A G 5: 100,698,911 probably null Het
Insc T C 7: 114,846,473 L472P probably damaging Het
Itgax A C 7: 128,140,418 probably null Het
Lair1 A G 7: 4,010,804 V148A probably benign Het
Lama2 A G 10: 27,223,981 probably null Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgr5 T C 10: 115,452,174 D855G probably benign Het
Lrp1 C A 10: 127,575,044 R1425L possibly damaging Het
Lrp1b A G 2: 40,598,511 S4521P Het
Nbas A G 12: 13,356,895 Y831C probably damaging Het
Nek9 C A 12: 85,339,013 R70L probably benign Het
Nlrp2 A C 7: 5,328,528 L290V probably damaging Het
Nos1 T A 5: 117,900,542 I480N probably damaging Het
Olfr1253 T C 2: 89,752,814 N5D possibly damaging Het
Pcdhb13 C A 18: 37,444,818 Q750K possibly damaging Het
Pik3c2g C T 6: 139,882,060 T727I Het
Pik3r6 C A 11: 68,533,739 P390Q probably benign Het
Pramel1 T C 4: 143,397,240 S162P probably benign Het
Psg21 A G 7: 18,647,211 M469T probably benign Het
Psg27 A T 7: 18,565,199 W66R probably damaging Het
Sbno2 A G 10: 80,068,351 C371R probably damaging Het
Shroom1 G T 11: 53,464,322 K329N possibly damaging Het
Slc35a3 A G 3: 116,687,335 I93T possibly damaging Het
Slc38a2 G A 15: 96,692,572 T297M probably benign Het
Sorl1 T A 9: 41,991,401 D1620V probably damaging Het
Srsf4 T A 4: 131,891,233 L45Q probably benign Het
Tcaf2 G A 6: 42,629,706 S438L probably benign Het
Tmem2 T C 19: 21,798,430 probably null Het
Trappc11 T A 8: 47,526,944 I186L possibly damaging Het
Usp9y A T Y: 1,316,914 N1878K probably benign Het
Wdr63 T C 3: 146,068,776 N439D probably benign Het
Zfp280d T A 9: 72,322,458 M349K probably damaging Het
Zgpat A G 2: 181,378,481 H227R probably benign Het
Other mutations in Ap3d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ap3d1 APN 10 80741979 missense probably benign 0.00
IGL00827:Ap3d1 APN 10 80713559 missense possibly damaging 0.92
IGL01668:Ap3d1 APN 10 80719159 missense possibly damaging 0.95
IGL01934:Ap3d1 APN 10 80709258 nonsense probably null
IGL03404:Ap3d1 APN 10 80730037 missense probably damaging 1.00
christian UTSW 10 80730042 missense probably damaging 1.00
R0119:Ap3d1 UTSW 10 80723615 splice site probably benign
R0197:Ap3d1 UTSW 10 80730042 missense probably damaging 1.00
R0356:Ap3d1 UTSW 10 80727978 missense probably damaging 1.00
R0372:Ap3d1 UTSW 10 80723567 missense probably damaging 1.00
R0491:Ap3d1 UTSW 10 80719241 missense probably damaging 1.00
R0636:Ap3d1 UTSW 10 80719382 nonsense probably null
R0792:Ap3d1 UTSW 10 80708479 missense probably benign
R0942:Ap3d1 UTSW 10 80732955 splice site probably benign
R1015:Ap3d1 UTSW 10 80716489 missense probably damaging 1.00
R1023:Ap3d1 UTSW 10 80714258 missense probably damaging 1.00
R1170:Ap3d1 UTSW 10 80732840 splice site probably benign
R1540:Ap3d1 UTSW 10 80715941 missense probably benign 0.00
R1639:Ap3d1 UTSW 10 80730010 missense probably damaging 0.98
R1664:Ap3d1 UTSW 10 80717737 nonsense probably null
R1669:Ap3d1 UTSW 10 80710836 unclassified probably benign
R1839:Ap3d1 UTSW 10 80727108 missense probably damaging 1.00
R1940:Ap3d1 UTSW 10 80709773 missense probably benign 0.03
R2081:Ap3d1 UTSW 10 80732936 missense probably damaging 1.00
R2258:Ap3d1 UTSW 10 80721132 missense probably benign 0.03
R2281:Ap3d1 UTSW 10 80713998 missense probably damaging 0.96
R2398:Ap3d1 UTSW 10 80719172 nonsense probably null
R2849:Ap3d1 UTSW 10 80741908 missense possibly damaging 0.65
R3856:Ap3d1 UTSW 10 80712185 missense probably benign
R4350:Ap3d1 UTSW 10 80719285 missense probably benign 0.15
R4590:Ap3d1 UTSW 10 80719812 nonsense probably null
R4782:Ap3d1 UTSW 10 80721586 splice site probably null
R4785:Ap3d1 UTSW 10 80712778 frame shift probably null
R4834:Ap3d1 UTSW 10 80719726 missense probably damaging 1.00
R4864:Ap3d1 UTSW 10 80712778 frame shift probably null
R5051:Ap3d1 UTSW 10 80719199 missense probably damaging 1.00
R5109:Ap3d1 UTSW 10 80709450 missense probably benign 0.11
R5219:Ap3d1 UTSW 10 80709817 missense probably benign 0.03
R5220:Ap3d1 UTSW 10 80727167 missense probably damaging 1.00
R5307:Ap3d1 UTSW 10 80723549 missense probably benign 0.29
R5586:Ap3d1 UTSW 10 80719130 missense possibly damaging 0.92
R5796:Ap3d1 UTSW 10 80714037 missense possibly damaging 0.70
R5905:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6025:Ap3d1 UTSW 10 80710464 missense probably benign 0.01
R6028:Ap3d1 UTSW 10 80722927 missense possibly damaging 0.50
R6364:Ap3d1 UTSW 10 80710494 splice site probably null
R6469:Ap3d1 UTSW 10 80712158 missense probably benign
R6603:Ap3d1 UTSW 10 80714047 missense probably benign 0.04
R6872:Ap3d1 UTSW 10 80714322 nonsense probably null
R6887:Ap3d1 UTSW 10 80723698 missense probably damaging 1.00
R7249:Ap3d1 UTSW 10 80741933 missense probably damaging 1.00
R7316:Ap3d1 UTSW 10 80717859 missense probably damaging 1.00
R7325:Ap3d1 UTSW 10 80723803 missense probably damaging 1.00
R7395:Ap3d1 UTSW 10 80730882 missense probably benign 0.11
R7405:Ap3d1 UTSW 10 80741900 missense probably benign 0.16
R7425:Ap3d1 UTSW 10 80721592 missense probably damaging 1.00
R7558:Ap3d1 UTSW 10 80722921 missense possibly damaging 0.92
R7583:Ap3d1 UTSW 10 80709458 missense probably benign 0.13
R7703:Ap3d1 UTSW 10 80717844 missense probably damaging 1.00
R8021:Ap3d1 UTSW 10 80714301 missense probably benign 0.30
R8200:Ap3d1 UTSW 10 80722932 nonsense probably null
R8314:Ap3d1 UTSW 10 80723539 missense possibly damaging 0.91
R8356:Ap3d1 UTSW 10 80732903 missense probably damaging 1.00
X0019:Ap3d1 UTSW 10 80719102 missense probably damaging 1.00
X0026:Ap3d1 UTSW 10 80721147 missense possibly damaging 0.46
Z1088:Ap3d1 UTSW 10 80719237 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCATCTGCTGAGACACAGGG -3'
(R):5'- TGTACAGCAATGAAGCTAGAACC -3'

Sequencing Primer
(F):5'- CATCTGCTGAGACACAGGGGATATG -3'
(R):5'- AGAACCATCTGCATGTGCTG -3'
Posted On2020-09-15