Incidental Mutation 'R7964:Pik3r6'
ID650285
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7964 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68503019-68552698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68533739 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 390 (P390Q)
Ref Sequence ENSEMBL: ENSMUSP00000052522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060441] [ENSMUST00000102613]
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: P390Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: P390Q

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: P390Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: P390Q

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,298,234 R2102L unknown Het
Abca13 A T 11: 9,316,146 M3042L probably benign Het
Abca3 T A 17: 24,402,436 L1345Q probably benign Het
Adam20 G T 8: 40,796,907 V685F probably damaging Het
Adam25 T A 8: 40,755,539 I614N probably damaging Het
Aldh1a7 C T 19: 20,700,007 V417M probably damaging Het
Aldh1a7 C T 19: 20,716,042 G171D probably benign Het
Aloxe3 T C 11: 69,126,536 F45S probably damaging Het
Ankrd26 T C 6: 118,523,199 I1104V probably benign Het
Ap3d1 C A 10: 80,730,057 R92L probably damaging Het
Aspm A G 1: 139,480,686 Q2437R probably damaging Het
Bcl11a T C 11: 24,163,353 I232T probably benign Het
Cfap97 A G 8: 46,170,200 D209G possibly damaging Het
Csmd2 A G 4: 128,523,510 M2754V Het
Dcdc2c A G 12: 28,470,319 I586T Het
Dkk4 T C 8: 22,625,352 C73R probably damaging Het
Dzip3 T C 16: 48,951,905 D467G probably damaging Het
Eif5 T C 12: 111,540,174 F67L probably benign Het
Elmod1 A G 9: 53,931,576 I100T probably benign Het
Gm9837 A G 11: 53,470,174 L71P unknown Het
Hpse A G 5: 100,698,911 probably null Het
Insc T C 7: 114,846,473 L472P probably damaging Het
Itgax A C 7: 128,140,418 probably null Het
Lair1 A G 7: 4,010,804 V148A probably benign Het
Lama2 A G 10: 27,223,981 probably null Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgr5 T C 10: 115,452,174 D855G probably benign Het
Lrp1 C A 10: 127,575,044 R1425L possibly damaging Het
Lrp1b A G 2: 40,598,511 S4521P Het
Nbas A G 12: 13,356,895 Y831C probably damaging Het
Nek9 C A 12: 85,339,013 R70L probably benign Het
Nlrp2 A C 7: 5,328,528 L290V probably damaging Het
Nos1 T A 5: 117,900,542 I480N probably damaging Het
Olfr1253 T C 2: 89,752,814 N5D possibly damaging Het
Pcdhb13 C A 18: 37,444,818 Q750K possibly damaging Het
Pik3c2g C T 6: 139,882,060 T727I Het
Pramel1 T C 4: 143,397,240 S162P probably benign Het
Psg21 A G 7: 18,647,211 M469T probably benign Het
Psg27 A T 7: 18,565,199 W66R probably damaging Het
Sbno2 A G 10: 80,068,351 C371R probably damaging Het
Shroom1 G T 11: 53,464,322 K329N possibly damaging Het
Slc35a3 A G 3: 116,687,335 I93T possibly damaging Het
Slc38a2 G A 15: 96,692,572 T297M probably benign Het
Sorl1 T A 9: 41,991,401 D1620V probably damaging Het
Srsf4 T A 4: 131,891,233 L45Q probably benign Het
Tcaf2 G A 6: 42,629,706 S438L probably benign Het
Tmem2 T C 19: 21,798,430 probably null Het
Trappc11 T A 8: 47,526,944 I186L possibly damaging Het
Usp9y A T Y: 1,316,914 N1878K probably benign Het
Wdr63 T C 3: 146,068,776 N439D probably benign Het
Zfp280d T A 9: 72,322,458 M349K probably damaging Het
Zgpat A G 2: 181,378,481 H227R probably benign Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68534251 missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68551321 missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68533619 missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68528826 critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68531450 missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68526412 missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68527105 missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68544750 missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68526408 nonsense probably null
R0454:Pik3r6 UTSW 11 68528782 missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68536101 splice site probably benign
R1119:Pik3r6 UTSW 11 68545872 missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68531445 missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68536106 missense probably benign
R1831:Pik3r6 UTSW 11 68544034 missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68543611 nonsense probably null
R4013:Pik3r6 UTSW 11 68533521 missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68544775 missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68529894 missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68544053 splice site probably benign
R4974:Pik3r6 UTSW 11 68539945 missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68533468 nonsense probably null
R5787:Pik3r6 UTSW 11 68539927 missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68525671 nonsense probably null
R6164:Pik3r6 UTSW 11 68551973 missense probably benign 0.00
R6192:Pik3r6 UTSW 11 68543629 missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68533696 missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68528563 missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68533875 missense probably benign 0.00
R8515:Pik3r6 UTSW 11 68539957 missense probably damaging 1.00
W0251:Pik3r6 UTSW 11 68533871 missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68525602 missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68520200 start gained probably benign
Z1176:Pik3r6 UTSW 11 68544765 missense probably benign 0.12
Z1177:Pik3r6 UTSW 11 68551227 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCAGTGCTGATCTGGATG -3'
(R):5'- ATACCACAGTCCCTCCTTAGG -3'

Sequencing Primer
(F):5'- ATCTGGATGCCTTGGATCTACAAG -3'
(R):5'- GGTCCTACCTGAGTCTGTAGTAAGC -3'
Posted On2020-09-15