Incidental Mutation 'R7964:Dzip3'
ID650292
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7964 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48951905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 467 (D467G)
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect probably benign
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121869
AA Change: D467G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061
AA Change: D467G

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,298,234 R2102L unknown Het
Abca13 A T 11: 9,316,146 M3042L probably benign Het
Abca3 T A 17: 24,402,436 L1345Q probably benign Het
Adam20 G T 8: 40,796,907 V685F probably damaging Het
Adam25 T A 8: 40,755,539 I614N probably damaging Het
Aldh1a7 C T 19: 20,700,007 V417M probably damaging Het
Aldh1a7 C T 19: 20,716,042 G171D probably benign Het
Aloxe3 T C 11: 69,126,536 F45S probably damaging Het
Ankrd26 T C 6: 118,523,199 I1104V probably benign Het
Ap3d1 C A 10: 80,730,057 R92L probably damaging Het
Aspm A G 1: 139,480,686 Q2437R probably damaging Het
Bcl11a T C 11: 24,163,353 I232T probably benign Het
Cfap97 A G 8: 46,170,200 D209G possibly damaging Het
Csmd2 A G 4: 128,523,510 M2754V Het
Dcdc2c A G 12: 28,470,319 I586T Het
Dkk4 T C 8: 22,625,352 C73R probably damaging Het
Eif5 T C 12: 111,540,174 F67L probably benign Het
Elmod1 A G 9: 53,931,576 I100T probably benign Het
Gm9837 A G 11: 53,470,174 L71P unknown Het
Hpse A G 5: 100,698,911 probably null Het
Insc T C 7: 114,846,473 L472P probably damaging Het
Itgax A C 7: 128,140,418 probably null Het
Lair1 A G 7: 4,010,804 V148A probably benign Het
Lama2 A G 10: 27,223,981 probably null Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Lgr5 T C 10: 115,452,174 D855G probably benign Het
Lrp1 C A 10: 127,575,044 R1425L possibly damaging Het
Lrp1b A G 2: 40,598,511 S4521P Het
Nbas A G 12: 13,356,895 Y831C probably damaging Het
Nek9 C A 12: 85,339,013 R70L probably benign Het
Nlrp2 A C 7: 5,328,528 L290V probably damaging Het
Nos1 T A 5: 117,900,542 I480N probably damaging Het
Olfr1253 T C 2: 89,752,814 N5D possibly damaging Het
Pcdhb13 C A 18: 37,444,818 Q750K possibly damaging Het
Pik3c2g C T 6: 139,882,060 T727I Het
Pik3r6 C A 11: 68,533,739 P390Q probably benign Het
Pramel1 T C 4: 143,397,240 S162P probably benign Het
Psg21 A G 7: 18,647,211 M469T probably benign Het
Psg27 A T 7: 18,565,199 W66R probably damaging Het
Sbno2 A G 10: 80,068,351 C371R probably damaging Het
Shroom1 G T 11: 53,464,322 K329N possibly damaging Het
Slc35a3 A G 3: 116,687,335 I93T possibly damaging Het
Slc38a2 G A 15: 96,692,572 T297M probably benign Het
Sorl1 T A 9: 41,991,401 D1620V probably damaging Het
Srsf4 T A 4: 131,891,233 L45Q probably benign Het
Tcaf2 G A 6: 42,629,706 S438L probably benign Het
Tmem2 T C 19: 21,798,430 probably null Het
Trappc11 T A 8: 47,526,944 I186L possibly damaging Het
Usp9y A T Y: 1,316,914 N1878K probably benign Het
Wdr63 T C 3: 146,068,776 N439D probably benign Het
Zfp280d T A 9: 72,322,458 M349K probably damaging Het
Zgpat A G 2: 181,378,481 H227R probably benign Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4371:Dzip3 UTSW 16 48943455 critical splice donor site probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
R7436:Dzip3 UTSW 16 48951989 missense probably damaging 1.00
R7469:Dzip3 UTSW 16 48944879 missense probably benign
R7526:Dzip3 UTSW 16 48975474 missense probably damaging 0.99
R8131:Dzip3 UTSW 16 48933793 critical splice donor site probably null
R8188:Dzip3 UTSW 16 48952136 missense probably damaging 1.00
R8209:Dzip3 UTSW 16 48977944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATCCCAAGGCGCAGAAG -3'
(R):5'- GCAAATATTTGATGAGGCTATGCC -3'

Sequencing Primer
(F):5'- GAACTGTAACTCGGTGAGACCATTC -3'
(R):5'- GCTATGCCACCCACTCTTTTG -3'
Posted On2020-09-15