Incidental Mutation 'R7965:Zc3h4'
ID650317
Institutional Source Beutler Lab
Gene Symbol Zc3h4
Ensembl Gene ENSMUSG00000059273
Gene Namezinc finger CCCH-type containing 4
SynonymsLOC330474, Kiaa1064-hp, Bwq1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7965 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16400910-16437696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16429845 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 655 (F655S)
Ref Sequence ENSEMBL: ENSMUSP00000096386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098789] [ENSMUST00000209289]
Predicted Effect unknown
Transcript: ENSMUST00000098789
AA Change: F655S
SMART Domains Protein: ENSMUSP00000096386
Gene: ENSMUSG00000059273
AA Change: F655S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 35 97 N/A INTRINSIC
low complexity region 144 170 N/A INTRINSIC
low complexity region 184 247 N/A INTRINSIC
low complexity region 264 324 N/A INTRINSIC
ZnF_C3H1 341 366 1.95e-3 SMART
ZnF_C3H1 370 395 6.17e-6 SMART
ZnF_C3H1 396 419 3.38e-1 SMART
low complexity region 433 451 N/A INTRINSIC
low complexity region 456 486 N/A INTRINSIC
low complexity region 489 505 N/A INTRINSIC
low complexity region 552 641 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
coiled coil region 729 760 N/A INTRINSIC
internal_repeat_2 767 822 3.38e-5 PROSPERO
low complexity region 837 850 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
internal_repeat_2 986 1037 3.38e-5 PROSPERO
low complexity region 1049 1072 N/A INTRINSIC
low complexity region 1077 1097 N/A INTRINSIC
low complexity region 1175 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000209289
AA Change: F663S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,658,412 T154A Het
Arhgap21 A G 2: 20,849,196 I1795T probably damaging Het
Arhgef4 T C 1: 34,811,681 V436A probably benign Het
Bche A T 3: 73,701,816 N92K probably damaging Het
Bmp2 C T 2: 133,561,185 H219Y probably benign Het
Cables1 T G 18: 11,840,212 V136G probably benign Het
Cacna1d G A 14: 30,047,313 R1887* probably null Het
Chrd A G 16: 20,739,153 E774G probably benign Het
Chrna2 A G 14: 66,151,076 *513W probably null Het
Cracr2b T C 7: 141,464,248 F131S probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyfip1 T A 7: 55,896,775 I545N possibly damaging Het
Ddx58 C A 4: 40,223,824 G397* probably null Het
Enpp3 T A 10: 24,778,819 T654S possibly damaging Het
Glce A G 9: 62,060,946 S308P probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmmr A C 11: 40,715,429 probably null Het
Hoxb9 A G 11: 96,274,638 N178D probably benign Het
Igkv10-94 A T 6: 68,704,611 F82I probably damaging Het
Igkv1-133 A T 6: 67,725,594 K99* probably null Het
Il4i1 A G 7: 44,840,395 Q528R probably benign Het
Inhba G T 13: 16,026,987 G378V possibly damaging Het
Katna1 T C 10: 7,738,859 S44P probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mgat4d T C 8: 83,358,093 V155A possibly damaging Het
Morc2b C T 17: 33,135,772 E1009K possibly damaging Het
Myo9a T A 9: 59,788,438 L341H probably damaging Het
Nell2 C T 15: 95,231,335 D716N probably damaging Het
Olfr1076 A G 2: 86,508,471 H4R probably benign Het
Olfr1101 A G 2: 86,988,363 V271A probably benign Het
Olfr354 A G 2: 36,906,941 probably benign Het
Olfr957 C T 9: 39,511,514 V69I probably benign Het
Ppp1r37 T C 7: 19,531,943 T633A probably damaging Het
Prdm10 A G 9: 31,347,006 K576E probably damaging Het
Prl2c5 G T 13: 13,185,884 M45I probably benign Het
Rnf44 A G 13: 54,682,854 S247P probably benign Het
Scn3a A G 2: 65,506,211 F684L probably damaging Het
Skint2 T A 4: 112,645,451 M286K probably benign Het
Slc39a9 G A 12: 80,666,676 G116D probably damaging Het
Smchd1 G A 17: 71,455,626 T206I possibly damaging Het
Tmem161a C T 8: 70,177,504 probably benign Het
Trpm6 T A 19: 18,876,110 H1831Q probably damaging Het
Trpm7 A T 2: 126,825,694 H792Q probably damaging Het
Ttc6 A G 12: 57,673,756 Q936R possibly damaging Het
Usp53 A T 3: 122,962,882 probably null Het
Vmn1r236 T A 17: 21,287,434 C271* probably null Het
Vmn2r70 T A 7: 85,561,863 M547L probably damaging Het
Vwa5b1 G A 4: 138,605,489 T254M probably damaging Het
Zfp605 G A 5: 110,127,450 G145S probably benign Het
Other mutations in Zc3h4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Zc3h4 APN 7 16422234 missense unknown
IGL00923:Zc3h4 APN 7 16429692 missense unknown
IGL01541:Zc3h4 APN 7 16434332 missense unknown
IGL02115:Zc3h4 APN 7 16425783 missense unknown
IGL02303:Zc3h4 APN 7 16434077 missense unknown
IGL02336:Zc3h4 APN 7 16425777 missense unknown
IGL02734:Zc3h4 APN 7 16423924 missense unknown
IGL02736:Zc3h4 APN 7 16417383 nonsense probably null
BB008:Zc3h4 UTSW 7 16432984 missense unknown
BB018:Zc3h4 UTSW 7 16432984 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0032:Zc3h4 UTSW 7 16434640 missense unknown
R0220:Zc3h4 UTSW 7 16429273 missense unknown
R0336:Zc3h4 UTSW 7 16435178 missense unknown
R0416:Zc3h4 UTSW 7 16420275 missense probably damaging 1.00
R0666:Zc3h4 UTSW 7 16434772 missense unknown
R0864:Zc3h4 UTSW 7 16420179 missense probably damaging 0.99
R1068:Zc3h4 UTSW 7 16429236 missense unknown
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1145:Zc3h4 UTSW 7 16416913 missense possibly damaging 0.53
R1472:Zc3h4 UTSW 7 16434770 missense unknown
R1665:Zc3h4 UTSW 7 16429580 missense unknown
R2087:Zc3h4 UTSW 7 16416940 missense possibly damaging 0.72
R2182:Zc3h4 UTSW 7 16422516 missense unknown
R2508:Zc3h4 UTSW 7 16434339 missense unknown
R3037:Zc3h4 UTSW 7 16421485 missense unknown
R4439:Zc3h4 UTSW 7 16429111 missense unknown
R4576:Zc3h4 UTSW 7 16434654 missense unknown
R5030:Zc3h4 UTSW 7 16422230 missense unknown
R5160:Zc3h4 UTSW 7 16434648 missense unknown
R5270:Zc3h4 UTSW 7 16434515 missense unknown
R5490:Zc3h4 UTSW 7 16429005 missense unknown
R5519:Zc3h4 UTSW 7 16435232 missense unknown
R5770:Zc3h4 UTSW 7 16429611 missense unknown
R7067:Zc3h4 UTSW 7 16429051 nonsense probably null
R7234:Zc3h4 UTSW 7 16429036 missense unknown
R7316:Zc3h4 UTSW 7 16435335 missense unknown
R7771:Zc3h4 UTSW 7 16429899 missense unknown
R7852:Zc3h4 UTSW 7 16422467 missense unknown
R7922:Zc3h4 UTSW 7 16425722 missense unknown
R7931:Zc3h4 UTSW 7 16432984 missense unknown
R8827:Zc3h4 UTSW 7 16429198 missense unknown
R8859:Zc3h4 UTSW 7 16435014 missense unknown
RF001:Zc3h4 UTSW 7 16429687 small insertion probably benign
RF039:Zc3h4 UTSW 7 16429618 small deletion probably benign
X0064:Zc3h4 UTSW 7 16422516 missense unknown
Predicted Primers PCR Primer
(F):5'- TGACATGCACCCTGACATG -3'
(R):5'- AATGGGACTGGAATGCTGC -3'

Sequencing Primer
(F):5'- GACATGCACCCTGACATGC -3'
(R):5'- ATGCTGCTGTAAGACTGGAC -3'
Posted On2020-09-15