Incidental Mutation 'R7965:Vmn2r70'
ID650321
Institutional Source Beutler Lab
Gene Symbol Vmn2r70
Ensembl Gene ENSMUSG00000090806
Gene Namevomeronasal 2, receptor 70
SynonymsEG620835
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R7965 (G1)
Quality Score159.009
Status Not validated
Chromosome7
Chromosomal Location85558703-85569088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85561863 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 547 (M547L)
Ref Sequence ENSEMBL: ENSMUSP00000129703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168230]
Predicted Effect probably damaging
Transcript: ENSMUST00000168230
AA Change: M547L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129703
Gene: ENSMUSG00000090806
AA Change: M547L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 77 468 2.5e-28 PFAM
Pfam:NCD3G 510 562 1.5e-19 PFAM
Pfam:7tm_3 592 830 1.2e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,658,412 T154A Het
Arhgap21 A G 2: 20,849,196 I1795T probably damaging Het
Arhgef4 T C 1: 34,811,681 V436A probably benign Het
Bche A T 3: 73,701,816 N92K probably damaging Het
Bmp2 C T 2: 133,561,185 H219Y probably benign Het
Cables1 T G 18: 11,840,212 V136G probably benign Het
Cacna1d G A 14: 30,047,313 R1887* probably null Het
Chrd A G 16: 20,739,153 E774G probably benign Het
Chrna2 A G 14: 66,151,076 *513W probably null Het
Cracr2b T C 7: 141,464,248 F131S probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyfip1 T A 7: 55,896,775 I545N possibly damaging Het
Ddx58 C A 4: 40,223,824 G397* probably null Het
Enpp3 T A 10: 24,778,819 T654S possibly damaging Het
Glce A G 9: 62,060,946 S308P probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hoxb9 A G 11: 96,274,638 N178D probably benign Het
Igkv10-94 A T 6: 68,704,611 F82I probably damaging Het
Igkv1-133 A T 6: 67,725,594 K99* probably null Het
Il4i1 A G 7: 44,840,395 Q528R probably benign Het
Inhba G T 13: 16,026,987 G378V possibly damaging Het
Katna1 T C 10: 7,738,859 S44P probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mgat4d T C 8: 83,358,093 V155A possibly damaging Het
Morc2b C T 17: 33,135,772 E1009K possibly damaging Het
Myo9a T A 9: 59,788,438 L341H probably damaging Het
Nell2 C T 15: 95,231,335 D716N probably damaging Het
Olfr1076 A G 2: 86,508,471 H4R probably benign Het
Olfr1101 A G 2: 86,988,363 V271A probably benign Het
Olfr354 A G 2: 36,906,941 probably benign Het
Olfr957 C T 9: 39,511,514 V69I probably benign Het
Ppp1r37 T C 7: 19,531,943 T633A probably damaging Het
Prdm10 A G 9: 31,347,006 K576E probably damaging Het
Prl2c5 G T 13: 13,185,884 M45I probably benign Het
Rnf44 A G 13: 54,682,854 S247P probably benign Het
Scn3a A G 2: 65,506,211 F684L probably damaging Het
Skint2 T A 4: 112,645,451 M286K probably benign Het
Slc39a9 G A 12: 80,666,676 G116D probably damaging Het
Smchd1 G A 17: 71,455,626 T206I possibly damaging Het
Tmem161a C T 8: 70,177,504 probably benign Het
Trpm6 T A 19: 18,876,110 H1831Q probably damaging Het
Trpm7 A T 2: 126,825,694 H792Q probably damaging Het
Ttc6 A G 12: 57,673,756 Q936R possibly damaging Het
Usp53 A T 3: 122,962,882 probably null Het
Vmn1r236 T A 17: 21,287,434 C271* probably null Het
Vwa5b1 G A 4: 138,605,489 T254M probably damaging Het
Zc3h4 T C 7: 16,429,845 F655S unknown Het
Zfp605 G A 5: 110,127,450 G145S probably benign Het
Other mutations in Vmn2r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Vmn2r70 APN 7 85563799 missense probably benign 0.00
IGL01140:Vmn2r70 APN 7 85565171 nonsense probably null
IGL01287:Vmn2r70 APN 7 85569019 nonsense probably null
IGL01581:Vmn2r70 APN 7 85563914 splice site probably null
IGL01632:Vmn2r70 APN 7 85566072 missense probably benign 0.00
IGL01725:Vmn2r70 APN 7 85559386 missense probably damaging 1.00
IGL02244:Vmn2r70 APN 7 85565003 missense probably benign
IGL02288:Vmn2r70 APN 7 85565134 missense probably benign 0.31
IGL02313:Vmn2r70 APN 7 85565168 missense probably damaging 0.99
IGL02591:Vmn2r70 APN 7 85564945 missense probably damaging 0.96
IGL02725:Vmn2r70 APN 7 85565345 missense possibly damaging 0.46
IGL02797:Vmn2r70 APN 7 85559087 missense probably benign 0.00
R0045:Vmn2r70 UTSW 7 85566044 missense probably damaging 1.00
R0729:Vmn2r70 UTSW 7 85565904 missense probably benign 0.00
R0967:Vmn2r70 UTSW 7 85559619 missense probably damaging 0.99
R1217:Vmn2r70 UTSW 7 85559061 missense probably damaging 1.00
R1351:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R1387:Vmn2r70 UTSW 7 85558761 missense probably benign 0.12
R1483:Vmn2r70 UTSW 7 85559167 missense probably benign 0.04
R1796:Vmn2r70 UTSW 7 85563803 nonsense probably null
R1809:Vmn2r70 UTSW 7 85565922 missense probably benign 0.23
R2154:Vmn2r70 UTSW 7 85563715 missense possibly damaging 0.67
R2173:Vmn2r70 UTSW 7 85565082 missense probably benign
R2334:Vmn2r70 UTSW 7 85559592 missense probably benign 0.05
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R2871:Vmn2r70 UTSW 7 85559019 missense probably damaging 1.00
R3975:Vmn2r70 UTSW 7 85559332 missense probably benign 0.00
R4525:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4527:Vmn2r70 UTSW 7 85559579 missense probably damaging 1.00
R4535:Vmn2r70 UTSW 7 85565333 missense probably damaging 1.00
R5181:Vmn2r70 UTSW 7 85559179 missense probably damaging 0.99
R5600:Vmn2r70 UTSW 7 85563727 missense probably benign 0.07
R5641:Vmn2r70 UTSW 7 85559364 missense probably damaging 0.99
R5726:Vmn2r70 UTSW 7 85559107 missense probably damaging 1.00
R5943:Vmn2r70 UTSW 7 85565991 missense probably benign 0.09
R6166:Vmn2r70 UTSW 7 85565981 missense probably benign 0.25
R6272:Vmn2r70 UTSW 7 85558986 missense probably damaging 1.00
R6324:Vmn2r70 UTSW 7 85558879 missense probably benign 0.01
R6429:Vmn2r70 UTSW 7 85559068 missense probably damaging 1.00
R6449:Vmn2r70 UTSW 7 85564949 missense probably damaging 1.00
R6512:Vmn2r70 UTSW 7 85566097 missense probably benign
R7000:Vmn2r70 UTSW 7 85559611 missense probably damaging 0.99
R7141:Vmn2r70 UTSW 7 85558836 missense probably benign
R7153:Vmn2r70 UTSW 7 85565054 missense probably damaging 1.00
R7424:Vmn2r70 UTSW 7 85563868 missense probably damaging 1.00
R7565:Vmn2r70 UTSW 7 85565291 missense probably benign 0.35
R7567:Vmn2r70 UTSW 7 85565035 missense probably benign 0.41
R7593:Vmn2r70 UTSW 7 85566104 nonsense probably null
R7660:Vmn2r70 UTSW 7 85568922 missense probably damaging 0.99
R7806:Vmn2r70 UTSW 7 85559193 missense probably benign
R7892:Vmn2r70 UTSW 7 85559380 missense possibly damaging 0.58
R8052:Vmn2r70 UTSW 7 85563715 missense probably benign
R8251:Vmn2r70 UTSW 7 85565978 nonsense probably null
Z1088:Vmn2r70 UTSW 7 85564760 missense possibly damaging 0.53
Z1176:Vmn2r70 UTSW 7 85569045 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAGGGATCTACAATAGTGAGAC -3'
(R):5'- AACGAGGTCTTTCAGTGGATCTC -3'

Sequencing Primer
(F):5'- TTGAGAGAGTGAGAGAGAGAGAGAC -3'
(R):5'- ATCTCTGTTGGGTGAATCAATGG -3'
Posted On2020-09-15