Incidental Mutation 'R7965:Glce'
ID650328
Institutional Source Beutler Lab
Gene Symbol Glce
Ensembl Gene ENSMUSG00000032252
Gene Nameglucuronyl C5-epimerase
Synonyms1110017N23Rik, C130034A12Rik, Hsepi, heparan sulfate-glucuronic acid C5-epimerase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7965 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location62057248-62122655 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62060946 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 308 (S308P)
Ref Sequence ENSEMBL: ENSMUSP00000034785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034785] [ENSMUST00000185675]
Predicted Effect probably damaging
Transcript: ENSMUST00000034785
AA Change: S308P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034785
Gene: ENSMUSG00000032252
AA Change: S308P

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 1.5e-78 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185675
AA Change: S308P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139949
Gene: ENSMUSG00000032252
AA Change: S308P

DomainStartEndE-ValueType
transmembrane domain 12 29 N/A INTRINSIC
Pfam:C5-epim_C 417 608 6.1e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (45/45)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die immediately after birth showing severe developmental defects including renal agenesis, lung abnormalities, and skeletal malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,658,412 T154A Het
Arhgap21 A G 2: 20,849,196 I1795T probably damaging Het
Arhgef4 T C 1: 34,811,681 V436A probably benign Het
Bche A T 3: 73,701,816 N92K probably damaging Het
Bmp2 C T 2: 133,561,185 H219Y probably benign Het
Cables1 T G 18: 11,840,212 V136G probably benign Het
Cacna1d G A 14: 30,047,313 R1887* probably null Het
Chrd A G 16: 20,739,153 E774G probably benign Het
Chrna2 A G 14: 66,151,076 *513W probably null Het
Cracr2b T C 7: 141,464,248 F131S probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyfip1 T A 7: 55,896,775 I545N possibly damaging Het
Ddx58 C A 4: 40,223,824 G397* probably null Het
Enpp3 T A 10: 24,778,819 T654S possibly damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hmmr A C 11: 40,715,429 probably null Het
Hoxb9 A G 11: 96,274,638 N178D probably benign Het
Igkv10-94 A T 6: 68,704,611 F82I probably damaging Het
Igkv1-133 A T 6: 67,725,594 K99* probably null Het
Il4i1 A G 7: 44,840,395 Q528R probably benign Het
Inhba G T 13: 16,026,987 G378V possibly damaging Het
Katna1 T C 10: 7,738,859 S44P probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mgat4d T C 8: 83,358,093 V155A possibly damaging Het
Morc2b C T 17: 33,135,772 E1009K possibly damaging Het
Myo9a T A 9: 59,788,438 L341H probably damaging Het
Nell2 C T 15: 95,231,335 D716N probably damaging Het
Olfr1076 A G 2: 86,508,471 H4R probably benign Het
Olfr1101 A G 2: 86,988,363 V271A probably benign Het
Olfr354 A G 2: 36,906,941 probably benign Het
Olfr957 C T 9: 39,511,514 V69I probably benign Het
Ppp1r37 T C 7: 19,531,943 T633A probably damaging Het
Prdm10 A G 9: 31,347,006 K576E probably damaging Het
Prl2c5 G T 13: 13,185,884 M45I probably benign Het
Rnf44 A G 13: 54,682,854 S247P probably benign Het
Scn3a A G 2: 65,506,211 F684L probably damaging Het
Skint2 T A 4: 112,645,451 M286K probably benign Het
Slc39a9 G A 12: 80,666,676 G116D probably damaging Het
Smchd1 G A 17: 71,455,626 T206I possibly damaging Het
Tmem161a C T 8: 70,177,504 probably benign Het
Trpm6 T A 19: 18,876,110 H1831Q probably damaging Het
Trpm7 A T 2: 126,825,694 H792Q probably damaging Het
Ttc6 A G 12: 57,673,756 Q936R possibly damaging Het
Usp53 A T 3: 122,962,882 probably null Het
Vmn1r236 T A 17: 21,287,434 C271* probably null Het
Vmn2r70 T A 7: 85,561,863 M547L probably damaging Het
Vwa5b1 G A 4: 138,605,489 T254M probably damaging Het
Zc3h4 T C 7: 16,429,845 F655S unknown Het
Zfp605 G A 5: 110,127,450 G145S probably benign Het
Other mutations in Glce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Glce APN 9 62060483 missense probably damaging 1.00
IGL02005:Glce APN 9 62060577 missense probably damaging 1.00
IGL02093:Glce APN 9 62070539 missense probably damaging 1.00
IGL02102:Glce APN 9 62070601 utr 5 prime probably benign
IGL02243:Glce APN 9 62070140 missense probably damaging 1.00
IGL03099:Glce APN 9 62060062 missense probably benign 0.18
R0004:Glce UTSW 9 62068579 missense probably damaging 1.00
R0626:Glce UTSW 9 62061000 missense probably benign
R1204:Glce UTSW 9 62070567 missense probably damaging 0.99
R1436:Glce UTSW 9 62070010 splice site probably null
R1475:Glce UTSW 9 62060928 missense possibly damaging 0.75
R1622:Glce UTSW 9 62070561 missense possibly damaging 0.90
R1712:Glce UTSW 9 62070575 missense probably damaging 1.00
R1740:Glce UTSW 9 62070533 missense probably damaging 0.97
R2060:Glce UTSW 9 62060946 missense possibly damaging 0.83
R4424:Glce UTSW 9 62060253 missense probably damaging 1.00
R4893:Glce UTSW 9 62068495 missense probably benign
R5350:Glce UTSW 9 62060305 nonsense probably null
R5569:Glce UTSW 9 62070203 missense probably benign 0.35
R5666:Glce UTSW 9 62060511 missense probably damaging 1.00
R5670:Glce UTSW 9 62060511 missense probably damaging 1.00
R5743:Glce UTSW 9 62070540 missense probably damaging 1.00
R5909:Glce UTSW 9 62060144 missense probably damaging 1.00
R7091:Glce UTSW 9 62060588 missense probably damaging 1.00
R7139:Glce UTSW 9 62070434 nonsense probably null
R7549:Glce UTSW 9 62060993 missense probably damaging 1.00
R7854:Glce UTSW 9 62070491 missense probably benign 0.01
R8022:Glce UTSW 9 62060591 missense probably benign 0.08
R8264:Glce UTSW 9 62060430 missense probably benign
R8743:Glce UTSW 9 62060821 missense probably benign 0.01
X0057:Glce UTSW 9 62060370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTTAGAAAGGCCCACTCC -3'
(R):5'- CAAAGGTAAGCGGAAGTCATCC -3'

Sequencing Primer
(F):5'- CCTTTCCTGAGGTCAGTGAC -3'
(R):5'- AGCGGAAGTCATCCTTAATTTTGTG -3'
Posted On2020-09-15