Incidental Mutation 'R7965:Cables1'
ID650344
Institutional Source Beutler Lab
Gene Symbol Cables1
Ensembl Gene ENSMUSG00000040957
Gene NameCDK5 and Abl enzyme substrate 1
Synonymsik3-1, interactor-1 with cdk3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R7965 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location11839220-11945630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 11840212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 136 (V136G)
Ref Sequence ENSEMBL: ENSMUSP00000129463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046948] [ENSMUST00000171109]
Predicted Effect probably benign
Transcript: ENSMUST00000046948
AA Change: V136G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040639
Gene: ENSMUSG00000040957
AA Change: V136G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 456 544 1.83e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171109
AA Change: V136G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129463
Gene: ENSMUSG00000040957
AA Change: V136G

DomainStartEndE-ValueType
low complexity region 2 31 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
low complexity region 81 88 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 108 138 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
CYCLIN 482 570 1.83e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulation of the cell cycle through interactions with several cyclin-dependent kinases. One study (PMID: 16177568) reported aberrant splicing of transcripts from this gene which results in removal of the cyclin binding domain only in human cancer cells, and reduction in gene expression was shown in colorectal cancers (PMID: 17982127).Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null females exhibited reduced fertility and uterine hyperplasia. With chronic exposure to estrogen, homozygous females develop endometrial adenocarcinoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 A G 18: 36,658,412 T154A Het
Arhgap21 A G 2: 20,849,196 I1795T probably damaging Het
Arhgef4 T C 1: 34,811,681 V436A probably benign Het
Bche A T 3: 73,701,816 N92K probably damaging Het
Bmp2 C T 2: 133,561,185 H219Y probably benign Het
Cacna1d G A 14: 30,047,313 R1887* probably null Het
Chrd A G 16: 20,739,153 E774G probably benign Het
Chrna2 A G 14: 66,151,076 *513W probably null Het
Cracr2b T C 7: 141,464,248 F131S probably damaging Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyfip1 T A 7: 55,896,775 I545N possibly damaging Het
Ddx58 C A 4: 40,223,824 G397* probably null Het
Enpp3 T A 10: 24,778,819 T654S possibly damaging Het
Glce A G 9: 62,060,946 S308P probably damaging Het
Hist2h3b C A 3: 96,268,993 Y100* probably null Het
Hoxb9 A G 11: 96,274,638 N178D probably benign Het
Igkv10-94 A T 6: 68,704,611 F82I probably damaging Het
Igkv1-133 A T 6: 67,725,594 K99* probably null Het
Il4i1 A G 7: 44,840,395 Q528R probably benign Het
Inhba G T 13: 16,026,987 G378V possibly damaging Het
Katna1 T C 10: 7,738,859 S44P probably benign Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Mgat4d T C 8: 83,358,093 V155A possibly damaging Het
Morc2b C T 17: 33,135,772 E1009K possibly damaging Het
Myo9a T A 9: 59,788,438 L341H probably damaging Het
Nell2 C T 15: 95,231,335 D716N probably damaging Het
Olfr1076 A G 2: 86,508,471 H4R probably benign Het
Olfr1101 A G 2: 86,988,363 V271A probably benign Het
Olfr354 A G 2: 36,906,941 probably benign Het
Olfr957 C T 9: 39,511,514 V69I probably benign Het
Ppp1r37 T C 7: 19,531,943 T633A probably damaging Het
Prdm10 A G 9: 31,347,006 K576E probably damaging Het
Prl2c5 G T 13: 13,185,884 M45I probably benign Het
Rnf44 A G 13: 54,682,854 S247P probably benign Het
Scn3a A G 2: 65,506,211 F684L probably damaging Het
Skint2 T A 4: 112,645,451 M286K probably benign Het
Slc39a9 G A 12: 80,666,676 G116D probably damaging Het
Smchd1 G A 17: 71,455,626 T206I possibly damaging Het
Tmem161a C T 8: 70,177,504 probably benign Het
Trpm6 T A 19: 18,876,110 H1831Q probably damaging Het
Trpm7 A T 2: 126,825,694 H792Q probably damaging Het
Ttc6 A G 12: 57,673,756 Q936R possibly damaging Het
Usp53 A T 3: 122,962,882 probably null Het
Vmn1r236 T A 17: 21,287,434 C271* probably null Het
Vmn2r70 T A 7: 85,561,863 M547L probably damaging Het
Vwa5b1 G A 4: 138,605,489 T254M probably damaging Het
Zc3h4 T C 7: 16,429,845 F655S unknown Het
Zfp605 G A 5: 110,127,450 G145S probably benign Het
Other mutations in Cables1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Cables1 APN 18 11944564 missense probably damaging 0.99
IGL01373:Cables1 APN 18 11888764 missense probably damaging 0.98
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R0058:Cables1 UTSW 18 11923413 missense possibly damaging 0.80
R2886:Cables1 UTSW 18 11939732 missense possibly damaging 0.80
R4691:Cables1 UTSW 18 11840523 nonsense probably null
R4845:Cables1 UTSW 18 11944488 missense probably damaging 0.99
R4964:Cables1 UTSW 18 11941277 missense possibly damaging 0.92
R5286:Cables1 UTSW 18 11924827 missense probably benign 0.11
R5756:Cables1 UTSW 18 11941353 missense probably damaging 1.00
R6755:Cables1 UTSW 18 11939825 missense probably null 1.00
R7162:Cables1 UTSW 18 11926366 critical splice donor site probably null
R7242:Cables1 UTSW 18 11840007 missense possibly damaging 0.93
R7410:Cables1 UTSW 18 11941225 missense probably benign
R7411:Cables1 UTSW 18 11840515 missense probably benign 0.01
Z1177:Cables1 UTSW 18 11941317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACATTTCTCTGGACGGACG -3'
(R):5'- CTGAGTGAACGAGTTGAGGC -3'

Sequencing Primer
(F):5'- CTGCAGGACCACGAGTG -3'
(R):5'- GACTGCCGCTCGTACTC -3'
Posted On2020-09-15