Mutagenetix > Incidental Mutation

Incidental Mutation 'R7965:Ctsf'

650346

Institutional Source

Beutler Lab

Gene Symbol

Ctsf

Ensembl Gene

ENSMUSG00000083282

Gene Name

cathepsin F

Synonyms

MMRRC Submission

046008-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R7965 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4905158-4910946 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4906567 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 165 (F165V)

Ref Sequence

ENSEMBL: ENSMUSP00000112481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]

AlphaFold

Q9R013

Predicted Effect

probably benign
Transcript: ENSMUST00000006626

SMART Domains

Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

Domain	Start	End	E-Value	Type
low complexity region	8	30	N/A	INTRINSIC
CH	46	146	1.4e-23	SMART
CH	159	258	4.83e-27	SMART
low complexity region	261	272	N/A	INTRINSIC
Pfam:Spectrin	287	397	5.5e-15	PFAM
SPEC	410	511	3.78e-23	SMART
SPEC	525	632	2.37e-6	SMART
Pfam:Spectrin	643	746	4.1e-15	PFAM
EFh	763	791	7.93e-1	SMART
EFh	799	827	5.96e-1	SMART
efhand_Ca_insen	830	896	2.29e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	111	122	N/A	INTRINSIC
low complexity region	145	156	N/A	INTRINSIC
Inhibitor_I29	165	222	5.41e-16	SMART
Pept_C1	249	460	4.2e-93	SMART

Meta Mutation Damage Score

0.8977

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	A	G	18: 36,791,465 (GRCm39)	T154A		Het
Arhgap21	A	G	2: 20,854,007 (GRCm39)	I1795T	probably damaging	Het
Arhgef4	T	C	1: 34,850,762 (GRCm39)	V436A	probably benign	Het
Bche	A	T	3: 73,609,149 (GRCm39)	N92K	probably damaging	Het
Bmp2	C	T	2: 133,403,105 (GRCm39)	H219Y	probably benign	Het
Cables1	T	G	18: 11,973,269 (GRCm39)	V136G	probably benign	Het
Cacna1d	G	A	14: 29,769,270 (GRCm39)	R1887*	probably null	Het
Chrd	A	G	16: 20,557,903 (GRCm39)	E774G	probably benign	Het
Chrna2	A	G	14: 66,388,525 (GRCm39)	*513W	probably null	Het
Cracr2b	T	C	7: 141,044,161 (GRCm39)	F131S	probably damaging	Het
Cyfip1	T	A	7: 55,546,523 (GRCm39)	I545N	possibly damaging	Het
Enpp3	T	A	10: 24,654,717 (GRCm39)	T654S	possibly damaging	Het
Glce	A	G	9: 61,968,228 (GRCm39)	S308P	probably damaging	Het
H3c13	C	A	3: 96,176,309 (GRCm39)	Y100*	probably null	Het
Hmmr	A	C	11: 40,606,256 (GRCm39)		probably null	Het
Hoxb9	A	G	11: 96,165,464 (GRCm39)	N178D	probably benign	Het
Igkv10-94	A	T	6: 68,681,595 (GRCm39)	F82I	probably damaging	Het
Igkv1-133	A	T	6: 67,702,578 (GRCm39)	K99*	probably null	Het
Il4i1	A	G	7: 44,489,819 (GRCm39)	Q528R	probably benign	Het
Inhba	G	T	13: 16,201,572 (GRCm39)	G378V	possibly damaging	Het
Katna1	T	C	10: 7,614,623 (GRCm39)	S44P	probably benign	Het
Ldlrad1	G	A	4: 107,066,688 (GRCm39)	A8T	probably benign	Het
Mgat4d	T	C	8: 84,084,722 (GRCm39)	V155A	possibly damaging	Het
Morc2b	C	T	17: 33,354,746 (GRCm39)	E1009K	possibly damaging	Het
Myo9a	T	A	9: 59,695,721 (GRCm39)	L341H	probably damaging	Het
Nell2	C	T	15: 95,129,216 (GRCm39)	D716N	probably damaging	Het
Or1n2	A	G	2: 36,796,953 (GRCm39)		probably benign	Het
Or5t16	A	G	2: 86,818,707 (GRCm39)	V271A	probably benign	Het
Or8g36	C	T	9: 39,422,810 (GRCm39)	V69I	probably benign	Het
Or8k30	A	G	2: 86,338,815 (GRCm39)	H4R	probably benign	Het
Ppp1r37	T	C	7: 19,265,868 (GRCm39)	T633A	probably damaging	Het
Prdm10	A	G	9: 31,258,302 (GRCm39)	K576E	probably damaging	Het
Prl2c5	G	T	13: 13,360,469 (GRCm39)	M45I	probably benign	Het
Rigi	C	A	4: 40,223,824 (GRCm39)	G397*	probably null	Het
Rnf44	A	G	13: 54,830,667 (GRCm39)	S247P	probably benign	Het
Scn3a	A	G	2: 65,336,555 (GRCm39)	F684L	probably damaging	Het
Skint2	T	A	4: 112,502,648 (GRCm39)	M286K	probably benign	Het
Slc39a9	G	A	12: 80,713,450 (GRCm39)	G116D	probably damaging	Het
Smchd1	G	A	17: 71,762,621 (GRCm39)	T206I	possibly damaging	Het
Tmem161a	C	T	8: 70,630,154 (GRCm39)		probably benign	Het
Trpm6	T	A	19: 18,853,474 (GRCm39)	H1831Q	probably damaging	Het
Trpm7	A	T	2: 126,667,614 (GRCm39)	H792Q	probably damaging	Het
Ttc6	A	G	12: 57,720,542 (GRCm39)	Q936R	possibly damaging	Het
Usp53	A	T	3: 122,756,531 (GRCm39)		probably null	Het
Vmn1r236	T	A	17: 21,507,696 (GRCm39)	C271*	probably null	Het
Vmn2r70	T	A	7: 85,211,071 (GRCm39)	M547L	probably damaging	Het
Vwa5b1	G	A	4: 138,332,800 (GRCm39)	T254M	probably damaging	Het
Zc3h4	T	C	7: 16,163,770 (GRCm39)	F655S	unknown	Het
Zfp605	G	A	5: 110,275,316 (GRCm39)	G145S	probably benign	Het

Other mutations in Ctsf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01631:Ctsf	APN	19	4,908,106 (GRCm39)	missense	probably damaging	1.00
IGL01891:Ctsf	APN	19	4,906,595 (GRCm39)	missense	probably damaging	0.99
IGL03291:Ctsf	APN	19	4,909,662 (GRCm39)	missense	probably benign	0.00
R0587:Ctsf	UTSW	19	4,905,766 (GRCm39)	missense	probably benign	0.35
R0831:Ctsf	UTSW	19	4,909,868 (GRCm39)	missense	possibly damaging	0.92
R1808:Ctsf	UTSW	19	4,906,562 (GRCm39)	missense	probably benign	0.00
R5652:Ctsf	UTSW	19	4,908,505 (GRCm39)	missense	probably damaging	1.00
R5662:Ctsf	UTSW	19	4,906,606 (GRCm39)	missense	probably damaging	0.98
R6993:Ctsf	UTSW	19	4,908,511 (GRCm39)	missense	probably benign	0.45
R7702:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7703:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7704:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7705:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7962:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
R7966:Ctsf	UTSW	19	4,906,567 (GRCm39)	missense	probably damaging	1.00
RF012:Ctsf	UTSW	19	4,908,694 (GRCm39)	missense	probably benign	0.05
Z1176:Ctsf	UTSW	19	4,906,334 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGAGAGACAAAGGCCCCTTAATC -3'
(R):5'- TCCTTGAGAGACACAGGATCC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'

Posted On

2020-09-15