Incidental Mutation 'R7966:Lcn3'
ID650350
Institutional Source Beutler Lab
Gene Symbol Lcn3
Ensembl Gene ENSMUSG00000026936
Gene Namelipocalin 3
SynonymsVnsp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7966 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location25765569-25768099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25766377 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 90 (K90E)
Ref Sequence ENSEMBL: ENSMUSP00000028304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028304]
Predicted Effect probably damaging
Transcript: ENSMUST00000028304
AA Change: K90E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028304
Gene: ENSMUSG00000026936
AA Change: K90E

DomainStartEndE-ValueType
Pfam:Lipocalin 37 171 2.5e-23 PFAM
Meta Mutation Damage Score 0.3651 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,088 Y117N probably benign Het
2700049A03Rik A T 12: 71,173,129 I817L probably benign Het
Adcy8 A T 15: 64,702,090 W1055R probably damaging Het
Anks4b A G 7: 120,182,700 E318G probably benign Het
Arid3a A G 10: 79,932,055 T229A probably benign Het
Cckar T C 5: 53,701,238 K247E possibly damaging Het
Cfap52 A T 11: 67,953,745 probably null Het
Ckap4 A G 10: 84,527,585 V538A probably damaging Het
Cped1 T C 6: 22,059,954 probably null Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp4v3 G T 8: 45,332,917 A21E probably benign Het
Cytip T C 2: 58,147,932 E140G probably damaging Het
D130043K22Rik A C 13: 24,893,423 Q1013P probably damaging Het
Dpp6 A G 5: 27,723,372 M763V probably benign Het
Eps15 T A 4: 109,321,143 Y193N probably damaging Het
Ghrhr T C 6: 55,379,098 W59R probably damaging Het
Hdac4 A G 1: 91,933,680 V1056A possibly damaging Het
Ipcef1 T C 10: 6,900,668 T312A probably damaging Het
Itpr3 T C 17: 27,112,028 probably null Het
Kif6 A G 17: 49,686,425 I182V probably damaging Het
Lig3 T C 11: 82,790,516 S446P probably damaging Het
Ncln G A 10: 81,490,269 Q283* probably null Het
Nlrp4c A G 7: 6,066,323 T408A probably damaging Het
Oas1h T C 5: 120,871,899 F346L probably damaging Het
Olfr1368 A T 13: 21,142,186 Y290* probably null Het
Olfr547 T C 7: 102,535,416 I223T probably damaging Het
Olfr591 A T 7: 103,172,855 F261I probably damaging Het
Olfr922 A G 9: 38,816,240 I246V probably benign Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,227,074 probably benign Het
Pdcd1 A T 1: 94,041,461 V44E probably damaging Het
Prdm13 A T 4: 21,679,932 I186N unknown Het
Prpf4b A G 13: 34,901,445 D958G probably damaging Het
Prune2 A G 19: 17,178,859 N2792S probably damaging Het
Robo1 T A 16: 72,983,872 I830N possibly damaging Het
Scaper A G 9: 55,762,327 V355A probably damaging Het
Scn3b C T 9: 40,282,550 A191V probably benign Het
Slc13a3 G C 2: 165,430,235 S296C probably benign Het
Slc6a16 T A 7: 45,268,053 I445N possibly damaging Het
Snrnp35 A G 5: 124,490,502 Y126C possibly damaging Het
Spock2 A G 10: 60,121,732 H98R possibly damaging Het
Sptssb A T 3: 69,820,953 Y50* probably null Het
Syne1 A G 10: 5,116,965 probably null Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tecta A G 9: 42,394,962 F57L probably damaging Het
Tgs1 C A 4: 3,586,215 P364H probably benign Het
Tmem242 A G 17: 5,411,436 I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r3 T A 3: 64,278,814 N150I probably damaging Het
Vmn2r69 A G 7: 85,411,554 I274T possibly damaging Het
Vwf T A 6: 125,639,341 L1206* probably null Het
Zfp157 T A 5: 138,447,571 W63R probably benign Het
Zfp455 T C 13: 67,199,238 Y10H probably benign Het
Zfp654 T C 16: 64,784,876 T447A probably damaging Het
Zhx2 T C 15: 57,821,667 I144T probably damaging Het
Other mutations in Lcn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02041:Lcn3 APN 2 25765624 missense probably benign 0.27
IGL02139:Lcn3 APN 2 25766634 missense possibly damaging 0.66
IGL02221:Lcn3 APN 2 25766160 missense probably benign 0.01
IGL02665:Lcn3 APN 2 25766404 missense possibly damaging 0.66
IGL03049:Lcn3 APN 2 25765574 start codon destroyed probably null 0.02
R0552:Lcn3 UTSW 2 25766409 critical splice donor site probably null
R3522:Lcn3 UTSW 2 25766121 missense possibly damaging 0.56
R4227:Lcn3 UTSW 2 25766111 missense probably benign 0.00
R6684:Lcn3 UTSW 2 25766158 missense probably benign 0.00
R6937:Lcn3 UTSW 2 25767811 nonsense probably null
R7010:Lcn3 UTSW 2 25766056 missense probably damaging 0.99
R7487:Lcn3 UTSW 2 25766162 critical splice donor site probably null
R8553:Lcn3 UTSW 2 25766335 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGGACATAGAGCTTTCTATCACAC -3'
(R):5'- AGTGACTACTGTGGCCTGAG -3'

Sequencing Primer
(F):5'- AGTGACTGTGGCTCCCATG -3'
(R):5'- CTGAGAGCCAAGGTCTAGGGTTC -3'
Posted On2020-09-15