Incidental Mutation 'R7966:Oas1h'
ID 650360
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name 2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission 046009-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7966 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 120999485-121011569 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121009962 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 346 (F346L)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000086368] [ENSMUST00000162096] [ENSMUST00000171820]
AlphaFold Q8VI97
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: F346L

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: F346L

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086368
SMART Domains Protein: ENSMUSP00000083555
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 1.6e-13 PFAM
Pfam:OAS1_C 164 349 6.9e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162096
SMART Domains Protein: ENSMUSP00000124597
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 42 138 1.1e-9 PFAM
Pfam:OAS1_C 163 231 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,219,903 (GRCm39) I817L probably benign Het
Adcy8 A T 15: 64,573,939 (GRCm39) W1055R probably damaging Het
Anks4b A G 7: 119,781,923 (GRCm39) E318G probably benign Het
Arid3a A G 10: 79,767,889 (GRCm39) T229A probably benign Het
Cckar T C 5: 53,858,580 (GRCm39) K247E possibly damaging Het
Cfap52 A T 11: 67,844,571 (GRCm39) probably null Het
Ckap4 A G 10: 84,363,449 (GRCm39) V538A probably damaging Het
Cped1 T C 6: 22,059,953 (GRCm39) probably null Het
Ctsf T G 19: 4,906,567 (GRCm39) F165V probably damaging Het
Cyp4v3 G T 8: 45,785,954 (GRCm39) A21E probably benign Het
Cytip T C 2: 58,037,944 (GRCm39) E140G probably damaging Het
D130043K22Rik A C 13: 25,077,406 (GRCm39) Q1013P probably damaging Het
Dpp6 A G 5: 27,928,370 (GRCm39) M763V probably benign Het
Eps15 T A 4: 109,178,340 (GRCm39) Y193N probably damaging Het
Ghrhr T C 6: 55,356,083 (GRCm39) W59R probably damaging Het
Hdac4 A G 1: 91,861,402 (GRCm39) V1056A possibly damaging Het
Ipcef1 T C 10: 6,850,668 (GRCm39) T312A probably damaging Het
Itpr3 T C 17: 27,331,002 (GRCm39) probably null Het
Kif6 A G 17: 49,993,453 (GRCm39) I182V probably damaging Het
Lcn3 A G 2: 25,656,389 (GRCm39) K90E probably damaging Het
Lig3 T C 11: 82,681,342 (GRCm39) S446P probably damaging Het
Ncln G A 10: 81,326,103 (GRCm39) Q283* probably null Het
Nlrp4c A G 7: 6,069,322 (GRCm39) T408A probably damaging Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,023,962 (GRCm39) probably benign Het
Or2ad1 A T 13: 21,326,356 (GRCm39) Y290* probably null Het
Or52b4 T C 7: 102,184,623 (GRCm39) I223T probably damaging Het
Or52s1b A T 7: 102,822,062 (GRCm39) F261I probably damaging Het
Or8b55 A G 9: 38,727,536 (GRCm39) I246V probably benign Het
Pdcd1 A T 1: 93,969,186 (GRCm39) V44E probably damaging Het
Prdm13 A T 4: 21,679,932 (GRCm39) I186N unknown Het
Prpf4b A G 13: 35,085,428 (GRCm39) D958G probably damaging Het
Prss59 A T 6: 40,903,022 (GRCm39) Y117N probably benign Het
Prune2 A G 19: 17,156,223 (GRCm39) N2792S probably damaging Het
Robo1 T A 16: 72,780,760 (GRCm39) I830N possibly damaging Het
Scaper A G 9: 55,669,611 (GRCm39) V355A probably damaging Het
Scn3b C T 9: 40,193,846 (GRCm39) A191V probably benign Het
Slc13a3 G C 2: 165,272,155 (GRCm39) S296C probably benign Het
Slc6a16 T A 7: 44,917,477 (GRCm39) I445N possibly damaging Het
Snrnp35 A G 5: 124,628,565 (GRCm39) Y126C possibly damaging Het
Spock2 A G 10: 59,957,554 (GRCm39) H98R possibly damaging Het
Sptssb A T 3: 69,728,286 (GRCm39) Y50* probably null Het
Syne1 A G 10: 5,066,965 (GRCm39) probably null Het
Tcf21 T C 10: 22,695,706 (GRCm39) T33A probably benign Het
Tecta A G 9: 42,306,258 (GRCm39) F57L probably damaging Het
Tgs1 C A 4: 3,586,215 (GRCm39) P364H probably benign Het
Tmem242 A G 17: 5,461,711 (GRCm39) I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,376,118 (GRCm39) probably null Het
Vmn2r3 T A 3: 64,186,235 (GRCm39) N150I probably damaging Het
Vmn2r69 A G 7: 85,060,762 (GRCm39) I274T possibly damaging Het
Vwf T A 6: 125,616,304 (GRCm39) L1206* probably null Het
Zfp157 T A 5: 138,445,833 (GRCm39) W63R probably benign Het
Zfp455 T C 13: 67,347,302 (GRCm39) Y10H probably benign Het
Zfp654 T C 16: 64,605,239 (GRCm39) T447A probably damaging Het
Zhx2 T C 15: 57,685,063 (GRCm39) I144T probably damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 121,009,897 (GRCm39) missense probably damaging 1.00
IGL01890:Oas1h APN 5 121,000,852 (GRCm39) splice site probably null
IGL02745:Oas1h APN 5 120,999,542 (GRCm39) missense probably benign 0.04
IGL02888:Oas1h APN 5 120,999,610 (GRCm39) missense probably benign 0.34
IGL02970:Oas1h APN 5 120,999,698 (GRCm39) missense possibly damaging 0.91
R0125:Oas1h UTSW 5 121,000,626 (GRCm39) nonsense probably null
R1261:Oas1h UTSW 5 121,009,930 (GRCm39) missense probably benign 0.01
R1506:Oas1h UTSW 5 121,009,951 (GRCm39) missense possibly damaging 0.66
R1565:Oas1h UTSW 5 121,000,663 (GRCm39) missense probably damaging 0.97
R1696:Oas1h UTSW 5 121,000,885 (GRCm39) critical splice donor site probably null
R1750:Oas1h UTSW 5 121,009,840 (GRCm39) splice site probably null
R3116:Oas1h UTSW 5 120,999,679 (GRCm39) nonsense probably null
R4814:Oas1h UTSW 5 121,000,728 (GRCm39) missense probably damaging 0.99
R4906:Oas1h UTSW 5 121,005,172 (GRCm39) nonsense probably null
R4944:Oas1h UTSW 5 121,000,846 (GRCm39) missense probably damaging 1.00
R4961:Oas1h UTSW 5 121,009,159 (GRCm39) missense probably damaging 1.00
R5160:Oas1h UTSW 5 121,009,145 (GRCm39) missense probably damaging 1.00
R5698:Oas1h UTSW 5 121,009,045 (GRCm39) missense probably damaging 1.00
R5903:Oas1h UTSW 5 121,009,040 (GRCm39) missense probably damaging 1.00
R6014:Oas1h UTSW 5 121,005,229 (GRCm39) missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120,999,528 (GRCm39) unclassified probably benign
R7975:Oas1h UTSW 5 121,009,890 (GRCm39) missense probably damaging 1.00
R8777:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Oas1h UTSW 5 121,005,107 (GRCm39) missense probably damaging 1.00
R8951:Oas1h UTSW 5 121,000,657 (GRCm39) missense probably damaging 1.00
R8987:Oas1h UTSW 5 121,005,152 (GRCm39) missense probably damaging 1.00
R9748:Oas1h UTSW 5 121,005,088 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGGATCCCTCTAGTCTTGCTG -3'
(R):5'- GCAGCTTGCCTTCACAGAAG -3'

Sequencing Primer
(F):5'- GGACACTTAGGCATGCATTG -3'
(R):5'- GCTTGCCTTCACAGAAGTGTAAAGAC -3'
Posted On 2020-09-15