Incidental Mutation 'R7966:Nlrp4c'
ID650368
Institutional Source Beutler Lab
Gene Symbol Nlrp4c
Ensembl Gene ENSMUSG00000034690
Gene NameNLR family, pyrin domain containing 4C
SynonymsNalp-alpha, Rnh2, Nalp4c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7966 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location6045161-6105150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6066323 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 408 (T408A)
Ref Sequence ENSEMBL: ENSMUSP00000046503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037728] [ENSMUST00000121583] [ENSMUST00000208360]
Predicted Effect probably damaging
Transcript: ENSMUST00000037728
AA Change: T408A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046503
Gene: ENSMUSG00000034690
AA Change: T408A

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 4.5e-40 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121583
AA Change: T408A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113824
Gene: ENSMUSG00000034690
AA Change: T408A

DomainStartEndE-ValueType
PYRIN 6 89 1.41e-34 SMART
Pfam:NACHT 148 317 1.7e-39 PFAM
LRR 689 716 2.91e0 SMART
LRR 718 745 1.49e1 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 6.24e1 SMART
LRR 802 829 3.07e-1 SMART
LRR 831 858 4.11e-1 SMART
LRR 859 886 3.31e-6 SMART
LRR 888 915 6.16e0 SMART
LRR 916 943 9.24e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000208360
AA Change: T408A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,088 Y117N probably benign Het
2700049A03Rik A T 12: 71,173,129 I817L probably benign Het
Adcy8 A T 15: 64,702,090 W1055R probably damaging Het
Anks4b A G 7: 120,182,700 E318G probably benign Het
Arid3a A G 10: 79,932,055 T229A probably benign Het
Cckar T C 5: 53,701,238 K247E possibly damaging Het
Cfap52 A T 11: 67,953,745 probably null Het
Ckap4 A G 10: 84,527,585 V538A probably damaging Het
Cped1 T C 6: 22,059,954 probably null Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cyp4v3 G T 8: 45,332,917 A21E probably benign Het
Cytip T C 2: 58,147,932 E140G probably damaging Het
D130043K22Rik A C 13: 24,893,423 Q1013P probably damaging Het
Dpp6 A G 5: 27,723,372 M763V probably benign Het
Eps15 T A 4: 109,321,143 Y193N probably damaging Het
Ghrhr T C 6: 55,379,098 W59R probably damaging Het
Hdac4 A G 1: 91,933,680 V1056A possibly damaging Het
Ipcef1 T C 10: 6,900,668 T312A probably damaging Het
Itpr3 T C 17: 27,112,028 probably null Het
Kif6 A G 17: 49,686,425 I182V probably damaging Het
Lcn3 A G 2: 25,766,377 K90E probably damaging Het
Lig3 T C 11: 82,790,516 S446P probably damaging Het
Ncln G A 10: 81,490,269 Q283* probably null Het
Oas1h T C 5: 120,871,899 F346L probably damaging Het
Olfr1368 A T 13: 21,142,186 Y290* probably null Het
Olfr547 T C 7: 102,535,416 I223T probably damaging Het
Olfr591 A T 7: 103,172,855 F261I probably damaging Het
Olfr922 A G 9: 38,816,240 I246V probably benign Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,227,074 probably benign Het
Pdcd1 A T 1: 94,041,461 V44E probably damaging Het
Prdm13 A T 4: 21,679,932 I186N unknown Het
Prpf4b A G 13: 34,901,445 D958G probably damaging Het
Prune2 A G 19: 17,178,859 N2792S probably damaging Het
Robo1 T A 16: 72,983,872 I830N possibly damaging Het
Scaper A G 9: 55,762,327 V355A probably damaging Het
Scn3b C T 9: 40,282,550 A191V probably benign Het
Slc13a3 G C 2: 165,430,235 S296C probably benign Het
Slc6a16 T A 7: 45,268,053 I445N possibly damaging Het
Snrnp35 A G 5: 124,490,502 Y126C possibly damaging Het
Spock2 A G 10: 60,121,732 H98R possibly damaging Het
Sptssb A T 3: 69,820,953 Y50* probably null Het
Syne1 A G 10: 5,116,965 probably null Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tecta A G 9: 42,394,962 F57L probably damaging Het
Tgs1 C A 4: 3,586,215 P364H probably benign Het
Tmem242 A G 17: 5,411,436 I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r3 T A 3: 64,278,814 N150I probably damaging Het
Vmn2r69 A G 7: 85,411,554 I274T possibly damaging Het
Vwf T A 6: 125,639,341 L1206* probably null Het
Zfp157 T A 5: 138,447,571 W63R probably benign Het
Zfp455 T C 13: 67,199,238 Y10H probably benign Het
Zfp654 T C 16: 64,784,876 T447A probably damaging Het
Zhx2 T C 15: 57,821,667 I144T probably damaging Het
Other mutations in Nlrp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Nlrp4c APN 7 6066702 missense possibly damaging 0.80
IGL01458:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01464:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01470:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01481:Nlrp4c APN 7 6100784 missense possibly damaging 0.94
IGL01531:Nlrp4c APN 7 6060656 missense probably damaging 1.00
IGL01595:Nlrp4c APN 7 6066112 nonsense probably null
IGL02087:Nlrp4c APN 7 6092583 missense probably damaging 1.00
IGL02226:Nlrp4c APN 7 6066829 missense possibly damaging 0.78
IGL02588:Nlrp4c APN 7 6084648 missense probably benign 0.25
IGL02822:Nlrp4c APN 7 6065727 missense probably damaging 1.00
IGL02884:Nlrp4c APN 7 6098952 missense probably damaging 1.00
IGL02943:Nlrp4c APN 7 6065975 missense probably damaging 0.96
IGL03017:Nlrp4c APN 7 6084680 missense probably benign 0.23
R0347:Nlrp4c UTSW 7 6066416 missense possibly damaging 0.69
R0579:Nlrp4c UTSW 7 6060845 missense probably benign 0.05
R1051:Nlrp4c UTSW 7 6065943 missense probably benign 0.01
R1596:Nlrp4c UTSW 7 6066778 missense probably benign
R1636:Nlrp4c UTSW 7 6066738 missense possibly damaging 0.64
R1739:Nlrp4c UTSW 7 6073222 missense probably damaging 1.00
R1766:Nlrp4c UTSW 7 6073114 missense probably benign 0.00
R1824:Nlrp4c UTSW 7 6066956 splice site probably null
R1827:Nlrp4c UTSW 7 6065766 missense probably damaging 1.00
R1858:Nlrp4c UTSW 7 6084656 missense probably benign 0.02
R1902:Nlrp4c UTSW 7 6065819 missense probably damaging 0.98
R2217:Nlrp4c UTSW 7 6073114 missense probably benign
R2415:Nlrp4c UTSW 7 6066048 missense probably damaging 1.00
R3004:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3005:Nlrp4c UTSW 7 6065525 missense probably benign 0.28
R3410:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3411:Nlrp4c UTSW 7 6092570 missense possibly damaging 0.69
R3710:Nlrp4c UTSW 7 6065628 missense probably damaging 0.99
R4072:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4073:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4075:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4076:Nlrp4c UTSW 7 6072710 missense probably benign 0.00
R4542:Nlrp4c UTSW 7 6100827 nonsense probably null
R4709:Nlrp4c UTSW 7 6065425 missense probably benign 0.31
R4776:Nlrp4c UTSW 7 6066126 missense probably benign 0.41
R5043:Nlrp4c UTSW 7 6066825 missense probably benign 0.01
R5258:Nlrp4c UTSW 7 6066623 missense probably benign 0.06
R6164:Nlrp4c UTSW 7 6092508 missense probably damaging 1.00
R6383:Nlrp4c UTSW 7 6066053 missense probably benign
R6650:Nlrp4c UTSW 7 6065949 missense probably damaging 0.99
R6810:Nlrp4c UTSW 7 6066755 missense probably damaging 1.00
R7095:Nlrp4c UTSW 7 6060793 missense probably damaging 0.97
R7102:Nlrp4c UTSW 7 6065709 nonsense probably null
R7104:Nlrp4c UTSW 7 6065709 nonsense probably null
R7232:Nlrp4c UTSW 7 6065709 nonsense probably null
R7444:Nlrp4c UTSW 7 6092596 nonsense probably null
R7705:Nlrp4c UTSW 7 6072636 missense probably damaging 0.97
R8506:Nlrp4c UTSW 7 6100776 missense possibly damaging 0.47
R8677:Nlrp4c UTSW 7 6072645 missense probably damaging 0.99
R8708:Nlrp4c UTSW 7 6065604 missense probably damaging 1.00
R8838:Nlrp4c UTSW 7 6066338 missense
R9031:Nlrp4c UTSW 7 6104609 makesense probably null
X0060:Nlrp4c UTSW 7 6065918 missense probably damaging 1.00
Z1088:Nlrp4c UTSW 7 6066636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGCTGTTCACTGTATGTC -3'
(R):5'- CTTTAGCAGATAAAAGATGGCTGC -3'

Sequencing Primer
(F):5'- GTATGTCAGGTCCCTGTGCTC -3'
(R):5'- AGATGGCTGCACAGACCTC -3'
Posted On2020-09-15