Incidental Mutation 'R7966:Cyp4v3'
ID650374
Institutional Source Beutler Lab
Gene Symbol Cyp4v3
Ensembl Gene ENSMUSG00000079057
Gene Namecytochrome P450, family 4, subfamily v, polypeptide 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7966 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location45304944-45333216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 45332917 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 21 (A21E)
Ref Sequence ENSEMBL: ENSMUSP00000092966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093526] [ENSMUST00000095328]
Predicted Effect probably benign
Transcript: ENSMUST00000093526
SMART Domains Protein: ENSMUSP00000091245
Gene: ENSMUSG00000070044

DomainStartEndE-ValueType
low complexity region 48 65 N/A INTRINSIC
low complexity region 96 111 N/A INTRINSIC
low complexity region 239 250 N/A INTRINSIC
low complexity region 262 274 N/A INTRINSIC
Pfam:DUF3719 305 370 4.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095328
AA Change: A21E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092966
Gene: ENSMUSG00000079057
AA Change: A21E

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 517 2.7e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135912
SMART Domains Protein: ENSMUSP00000120196
Gene: ENSMUSG00000070044

DomainStartEndE-ValueType
low complexity region 59 85 N/A INTRINSIC
low complexity region 90 108 N/A INTRINSIC
low complexity region 193 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
Pfam:DUF3719 259 324 2.7e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit corneoretinal crystal accumulation and systemic dyslipidemia characteristic of Bietti Crystalline Dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,088 Y117N probably benign Het
2700049A03Rik A T 12: 71,173,129 I817L probably benign Het
Adcy8 A T 15: 64,702,090 W1055R probably damaging Het
Anks4b A G 7: 120,182,700 E318G probably benign Het
Arid3a A G 10: 79,932,055 T229A probably benign Het
Cckar T C 5: 53,701,238 K247E possibly damaging Het
Cfap52 A T 11: 67,953,745 probably null Het
Ckap4 A G 10: 84,527,585 V538A probably damaging Het
Cped1 T C 6: 22,059,954 probably null Het
Ctsf T G 19: 4,856,539 F165V probably damaging Het
Cytip T C 2: 58,147,932 E140G probably damaging Het
D130043K22Rik A C 13: 24,893,423 Q1013P probably damaging Het
Dpp6 A G 5: 27,723,372 M763V probably benign Het
Eps15 T A 4: 109,321,143 Y193N probably damaging Het
Ghrhr T C 6: 55,379,098 W59R probably damaging Het
Hdac4 A G 1: 91,933,680 V1056A possibly damaging Het
Ipcef1 T C 10: 6,900,668 T312A probably damaging Het
Itpr3 T C 17: 27,112,028 probably null Het
Kif6 A G 17: 49,686,425 I182V probably damaging Het
Lcn3 A G 2: 25,766,377 K90E probably damaging Het
Lig3 T C 11: 82,790,516 S446P probably damaging Het
Ncln G A 10: 81,490,269 Q283* probably null Het
Nlrp4c A G 7: 6,066,323 T408A probably damaging Het
Oas1h T C 5: 120,871,899 F346L probably damaging Het
Olfr1368 A T 13: 21,142,186 Y290* probably null Het
Olfr547 T C 7: 102,535,416 I223T probably damaging Het
Olfr591 A T 7: 103,172,855 F261I probably damaging Het
Olfr922 A G 9: 38,816,240 I246V probably benign Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,227,074 probably benign Het
Pdcd1 A T 1: 94,041,461 V44E probably damaging Het
Prdm13 A T 4: 21,679,932 I186N unknown Het
Prpf4b A G 13: 34,901,445 D958G probably damaging Het
Prune2 A G 19: 17,178,859 N2792S probably damaging Het
Robo1 T A 16: 72,983,872 I830N possibly damaging Het
Scaper A G 9: 55,762,327 V355A probably damaging Het
Scn3b C T 9: 40,282,550 A191V probably benign Het
Slc13a3 G C 2: 165,430,235 S296C probably benign Het
Slc6a16 T A 7: 45,268,053 I445N possibly damaging Het
Snrnp35 A G 5: 124,490,502 Y126C possibly damaging Het
Spock2 A G 10: 60,121,732 H98R possibly damaging Het
Sptssb A T 3: 69,820,953 Y50* probably null Het
Syne1 A G 10: 5,116,965 probably null Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tecta A G 9: 42,394,962 F57L probably damaging Het
Tgs1 C A 4: 3,586,215 P364H probably benign Het
Tmem242 A G 17: 5,411,436 I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r3 T A 3: 64,278,814 N150I probably damaging Het
Vmn2r69 A G 7: 85,411,554 I274T possibly damaging Het
Vwf T A 6: 125,639,341 L1206* probably null Het
Zfp157 T A 5: 138,447,571 W63R probably benign Het
Zfp455 T C 13: 67,199,238 Y10H probably benign Het
Zfp654 T C 16: 64,784,876 T447A probably damaging Het
Zhx2 T C 15: 57,821,667 I144T probably damaging Het
Other mutations in Cyp4v3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cyp4v3 APN 8 45307003 missense probably benign 0.04
IGL00503:Cyp4v3 APN 8 45307021 missense probably damaging 0.98
IGL00757:Cyp4v3 APN 8 45320615 missense probably damaging 0.98
IGL02375:Cyp4v3 APN 8 45308374 splice site probably null
IGL02565:Cyp4v3 APN 8 45320637 missense possibly damaging 0.63
IGL02881:Cyp4v3 APN 8 45308716 missense probably damaging 1.00
R0745:Cyp4v3 UTSW 8 45308651 unclassified probably benign
R1818:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1819:Cyp4v3 UTSW 8 45315636 missense possibly damaging 0.77
R1902:Cyp4v3 UTSW 8 45306952 missense probably benign 0.00
R2426:Cyp4v3 UTSW 8 45317776 missense probably benign
R3747:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3748:Cyp4v3 UTSW 8 45315708 nonsense probably null
R3750:Cyp4v3 UTSW 8 45315708 nonsense probably null
R4289:Cyp4v3 UTSW 8 45328223 missense possibly damaging 0.46
R4569:Cyp4v3 UTSW 8 45306992 missense probably damaging 1.00
R4960:Cyp4v3 UTSW 8 45320637 missense possibly damaging 0.63
R5260:Cyp4v3 UTSW 8 45306980 missense probably damaging 1.00
R5479:Cyp4v3 UTSW 8 45310206 missense probably benign 0.00
R5667:Cyp4v3 UTSW 8 45308535 missense possibly damaging 0.94
R5940:Cyp4v3 UTSW 8 45321784 missense probably damaging 1.00
R6102:Cyp4v3 UTSW 8 45320160 missense probably damaging 1.00
R6470:Cyp4v3 UTSW 8 45317736 nonsense probably null
R6592:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
R6700:Cyp4v3 UTSW 8 45307093 missense probably damaging 1.00
R7027:Cyp4v3 UTSW 8 45310252 missense possibly damaging 0.93
R7341:Cyp4v3 UTSW 8 45321750 missense probably benign 0.01
R8331:Cyp4v3 UTSW 8 45315708 nonsense probably null
R8886:Cyp4v3 UTSW 8 45321748 nonsense probably null
R8955:Cyp4v3 UTSW 8 45308527 missense probably benign 0.00
R8957:Cyp4v3 UTSW 8 45306981 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CGGAGTAGACACTTCCTTGTAC -3'
(R):5'- AGATCTGAGAGGACCTGGTGTG -3'

Sequencing Primer
(F):5'- GTACATACACATACCTGCGTTGTTGG -3'
(R):5'- TTTCCTGAGCCCTGAGCCG -3'
Posted On2020-09-15