Incidental Mutation 'R7966:Ctsf'
ID650400
Institutional Source Beutler Lab
Gene Symbol Ctsf
Ensembl Gene ENSMUSG00000083282
Gene Namecathepsin F
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7966 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4855129-4860912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4856539 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 165 (F165V)
Ref Sequence ENSEMBL: ENSMUSP00000112481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006626] [ENSMUST00000119694]
Predicted Effect probably benign
Transcript: ENSMUST00000006626
SMART Domains Protein: ENSMUSP00000006626
Gene: ENSMUSG00000006457

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
CH 46 146 1.4e-23 SMART
CH 159 258 4.83e-27 SMART
low complexity region 261 272 N/A INTRINSIC
Pfam:Spectrin 287 397 5.5e-15 PFAM
SPEC 410 511 3.78e-23 SMART
SPEC 525 632 2.37e-6 SMART
Pfam:Spectrin 643 746 4.1e-15 PFAM
EFh 763 791 7.93e-1 SMART
EFh 799 827 5.96e-1 SMART
efhand_Ca_insen 830 896 2.29e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119694
AA Change: F165V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112481
Gene: ENSMUSG00000083282
AA Change: F165V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
Inhibitor_I29 165 222 5.41e-16 SMART
Pept_C1 249 460 4.2e-93 SMART
Meta Mutation Damage Score 0.8977 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele develop neuronal lipofuscinosis and late-onset neurological disease characterized by reduced brain mass, progressive hind leg weakness, impaired motor coordination, tremors, severe gliosis, general wasting, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,088 Y117N probably benign Het
2700049A03Rik A T 12: 71,173,129 I817L probably benign Het
Adcy8 A T 15: 64,702,090 W1055R probably damaging Het
Anks4b A G 7: 120,182,700 E318G probably benign Het
Arid3a A G 10: 79,932,055 T229A probably benign Het
Cckar T C 5: 53,701,238 K247E possibly damaging Het
Cfap52 A T 11: 67,953,745 probably null Het
Ckap4 A G 10: 84,527,585 V538A probably damaging Het
Cped1 T C 6: 22,059,954 probably null Het
Cyp4v3 G T 8: 45,332,917 A21E probably benign Het
Cytip T C 2: 58,147,932 E140G probably damaging Het
D130043K22Rik A C 13: 24,893,423 Q1013P probably damaging Het
Dpp6 A G 5: 27,723,372 M763V probably benign Het
Eps15 T A 4: 109,321,143 Y193N probably damaging Het
Ghrhr T C 6: 55,379,098 W59R probably damaging Het
Hdac4 A G 1: 91,933,680 V1056A possibly damaging Het
Ipcef1 T C 10: 6,900,668 T312A probably damaging Het
Itpr3 T C 17: 27,112,028 probably null Het
Kif6 A G 17: 49,686,425 I182V probably damaging Het
Lcn3 A G 2: 25,766,377 K90E probably damaging Het
Lig3 T C 11: 82,790,516 S446P probably damaging Het
Ncln G A 10: 81,490,269 Q283* probably null Het
Nlrp4c A G 7: 6,066,323 T408A probably damaging Het
Oas1h T C 5: 120,871,899 F346L probably damaging Het
Olfr1368 A T 13: 21,142,186 Y290* probably null Het
Olfr547 T C 7: 102,535,416 I223T probably damaging Het
Olfr591 A T 7: 103,172,855 F261I probably damaging Het
Olfr922 A G 9: 38,816,240 I246V probably benign Het
Olig2 AGCCGCCGCCGCCGCCGCAGCCGCCGCCGCCGC AGCCGCCGCCGCCGCAGCCGCCGCCGCCGC 16: 91,227,074 probably benign Het
Pdcd1 A T 1: 94,041,461 V44E probably damaging Het
Prdm13 A T 4: 21,679,932 I186N unknown Het
Prpf4b A G 13: 34,901,445 D958G probably damaging Het
Prune2 A G 19: 17,178,859 N2792S probably damaging Het
Robo1 T A 16: 72,983,872 I830N possibly damaging Het
Scaper A G 9: 55,762,327 V355A probably damaging Het
Scn3b C T 9: 40,282,550 A191V probably benign Het
Slc13a3 G C 2: 165,430,235 S296C probably benign Het
Slc6a16 T A 7: 45,268,053 I445N possibly damaging Het
Snrnp35 A G 5: 124,490,502 Y126C possibly damaging Het
Spock2 A G 10: 60,121,732 H98R possibly damaging Het
Sptssb A T 3: 69,820,953 Y50* probably null Het
Syne1 A G 10: 5,116,965 probably null Het
Tcf21 T C 10: 22,819,807 T33A probably benign Het
Tecta A G 9: 42,394,962 F57L probably damaging Het
Tgs1 C A 4: 3,586,215 P364H probably benign Het
Tmem242 A G 17: 5,411,436 I119T probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vmn2r3 T A 3: 64,278,814 N150I probably damaging Het
Vmn2r69 A G 7: 85,411,554 I274T possibly damaging Het
Vwf T A 6: 125,639,341 L1206* probably null Het
Zfp157 T A 5: 138,447,571 W63R probably benign Het
Zfp455 T C 13: 67,199,238 Y10H probably benign Het
Zfp654 T C 16: 64,784,876 T447A probably damaging Het
Zhx2 T C 15: 57,821,667 I144T probably damaging Het
Other mutations in Ctsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01631:Ctsf APN 19 4858078 missense probably damaging 1.00
IGL01891:Ctsf APN 19 4856567 missense probably damaging 0.99
IGL03291:Ctsf APN 19 4859634 missense probably benign 0.00
R0587:Ctsf UTSW 19 4855738 missense probably benign 0.35
R0831:Ctsf UTSW 19 4859840 missense possibly damaging 0.92
R1808:Ctsf UTSW 19 4856534 missense probably benign 0.00
R5652:Ctsf UTSW 19 4858477 missense probably damaging 1.00
R5662:Ctsf UTSW 19 4856578 missense probably damaging 0.98
R6993:Ctsf UTSW 19 4858483 missense probably benign 0.45
R7702:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7703:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7704:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7705:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7962:Ctsf UTSW 19 4856539 missense probably damaging 1.00
R7965:Ctsf UTSW 19 4856539 missense probably damaging 1.00
RF012:Ctsf UTSW 19 4858666 missense probably benign 0.05
Z1176:Ctsf UTSW 19 4856306 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGAGACAAAGGCCCCTTAATC -3'
(R):5'- GCTCCTTGAGAGACACAGGATC -3'

Sequencing Primer
(F):5'- AGACAAAGGCCCCTTAATCCTCTTTC -3'
(R):5'- GACACAATCCAGGCATTTTGGTC -3'
Posted On2020-09-15