Incidental Mutation 'R7967:Pld5'
ID 650402
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Name phospholipase D family, member 5
Synonyms B230365F16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7967 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 175962306-176275312 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 176274698 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 59 (D59E)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111166] [ENSMUST00000125404]
AlphaFold Q3UNN8
Predicted Effect probably benign
Transcript: ENSMUST00000065967
AA Change: D59E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: D59E

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111166
AA Change: D59E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000125404
AA Change: D59E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214
AA Change: D59E

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,194 G96D probably benign Het
Aadacl2 A G 3: 60,024,748 H228R probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atp11b C A 3: 35,841,043 T910K probably benign Het
Babam1 T A 8: 71,404,355 L320Q probably damaging Het
C530025M09Rik G A 2: 149,831,054 R54C unknown Het
Cilp A T 9: 65,278,212 I530F possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dgkh A G 14: 78,619,816 V302A probably benign Het
Eps8l3 A G 3: 107,891,288 K497E possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exosc10 A G 4: 148,564,664 D337G probably damaging Het
Fabp3 A T 4: 130,313,988 H94L probably damaging Het
Flrt3 T A 2: 140,659,891 K606* probably null Het
Grm5 A G 7: 87,975,361 T379A probably damaging Het
Hecw1 T A 13: 14,377,747 Y89F probably damaging Het
Hoxd8 T C 2: 74,706,034 S163P probably damaging Het
Itih4 T A 14: 30,892,413 I440N probably damaging Het
Jmjd1c A G 10: 67,249,682 D2236G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl31 G A 9: 77,650,148 E49K probably damaging Het
Mmp10 A G 9: 7,504,115 Y185C probably damaging Het
Mtus2 A T 5: 148,077,846 E483V probably benign Het
Myh7b A G 2: 155,614,199 probably null Het
Olfr1148 C T 2: 87,833,519 P160L possibly damaging Het
Orc3 A T 4: 34,598,645 M187K probably damaging Het
Pcdhb15 A G 18: 37,474,849 N378S probably damaging Het
Pgm2l1 A C 7: 100,261,647 H266P probably damaging Het
Ppp2r2c A G 5: 36,940,106 D212G possibly damaging Het
Rccd1 G A 7: 80,318,909 S301L possibly damaging Het
Shbg T A 11: 69,614,987 D398V probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tecta G A 9: 42,377,955 T438M possibly damaging Het
Trpm6 A T 19: 18,778,659 I89F probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ugt2b36 C A 5: 87,066,377 M469I probably damaging Het
Wdr66 G A 5: 123,283,516 R644H possibly damaging Het
Zfp599 A G 9: 22,249,534 V445A possibly damaging Het
Zmym6 T C 4: 127,122,660 C745R probably benign Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4373:Pld5 UTSW 1 176140017 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175993850 critical splice donor site probably null
R7805:Pld5 UTSW 1 176044914 missense probably damaging 1.00
R8038:Pld5 UTSW 1 176044897 missense probably benign 0.19
R8995:Pld5 UTSW 1 175964014 missense probably benign 0.01
R9033:Pld5 UTSW 1 176140019 missense probably damaging 0.99
R9067:Pld5 UTSW 1 176089908 missense probably benign 0.00
R9156:Pld5 UTSW 1 175975538 missense possibly damaging 0.73
R9156:Pld5 UTSW 1 176074437 missense probably benign 0.05
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGCAAACCTTTCTTTTCTCCATG -3'
(R):5'- CTGGTCATGTCAGGATGGAG -3'

Sequencing Primer
(F):5'- CTCCATGCAGTTGAGTCATTAAGG -3'
(R):5'- ATGGAGATCCGGCAGCAC -3'
Posted On 2020-09-15