Incidental Mutation 'R7967:Exosc10'
ID650413
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7967 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148564664 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000017408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably damaging
Transcript: ENSMUST00000017408
AA Change: D337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: D337G

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076022
AA Change: D337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: D337G

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097781
AA Change: D337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: D337G

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik G A 12: 55,304,194 G96D probably benign Het
Aadacl2 A G 3: 60,024,748 H228R probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atp11b C A 3: 35,841,043 T910K probably benign Het
Babam1 T A 8: 71,404,355 L320Q probably damaging Het
C530025M09Rik G A 2: 149,831,054 R54C unknown Het
Cilp A T 9: 65,278,212 I530F possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dgkh A G 14: 78,619,816 V302A probably benign Het
Eps8l3 A G 3: 107,891,288 K497E possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Fabp3 A T 4: 130,313,988 H94L probably damaging Het
Flrt3 T A 2: 140,659,891 K606* probably null Het
Grm5 A G 7: 87,975,361 T379A probably damaging Het
Hecw1 T A 13: 14,377,747 Y89F probably damaging Het
Hoxd8 T C 2: 74,706,034 S163P probably damaging Het
Itih4 T A 14: 30,892,413 I440N probably damaging Het
Jmjd1c A G 10: 67,249,682 D2236G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl31 G A 9: 77,650,148 E49K probably damaging Het
Mmp10 A G 9: 7,504,115 Y185C probably damaging Het
Mtus2 A T 5: 148,077,846 E483V probably benign Het
Myh7b A G 2: 155,614,199 probably null Het
Olfr1148 C T 2: 87,833,519 P160L possibly damaging Het
Orc3 A T 4: 34,598,645 M187K probably damaging Het
Pcdhb15 A G 18: 37,474,849 N378S probably damaging Het
Pgm2l1 A C 7: 100,261,647 H266P probably damaging Het
Pld5 A T 1: 176,274,698 D59E probably benign Het
Ppp2r2c A G 5: 36,940,106 D212G possibly damaging Het
Rccd1 G A 7: 80,318,909 S301L possibly damaging Het
Shbg T A 11: 69,614,987 D398V probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tecta G A 9: 42,377,955 T438M possibly damaging Het
Trpm6 A T 19: 18,778,659 I89F probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ugt2b36 C A 5: 87,066,377 M469I probably damaging Het
Wdr66 G A 5: 123,283,516 R644H possibly damaging Het
Zfp599 A G 9: 22,249,534 V445A possibly damaging Het
Zmym6 T C 4: 127,122,660 C745R probably benign Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 splice site probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6495:Exosc10 UTSW 4 148562872 missense probably benign 0.45
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
R8225:Exosc10 UTSW 4 148565204 missense possibly damaging 0.86
R8477:Exosc10 UTSW 4 148565390 missense possibly damaging 0.71
R8510:Exosc10 UTSW 4 148564189 missense probably damaging 1.00
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTAGCTAGCCATTAAGAACTG -3'
(R):5'- AGTTAAGCAGACAGGCGTGC -3'

Sequencing Primer
(F):5'- TAGCTAGCCATTAAGAACTGGTAGG -3'
(R):5'- ACAGGCGTGCTGAATGGC -3'
Posted On2020-09-15