Incidental Mutation 'R7967:1110008L16Rik'
ID650432
Institutional Source Beutler Lab
Gene Symbol 1110008L16Rik
Ensembl Gene ENSMUSG00000021023
Gene NameRIKEN cDNA 1110008L16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R7967 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location55299577-55382533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55304194 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 96 (G96D)
Ref Sequence ENSEMBL: ENSMUSP00000021411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000183475] [ENSMUST00000183654] [ENSMUST00000184766] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021411
AA Change: G96D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023
AA Change: G96D

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183475
AA Change: G96D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139252
Gene: ENSMUSG00000021023
AA Change: G96D

DomainStartEndE-ValueType
low complexity region 410 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183654
SMART Domains Protein: ENSMUSP00000138821
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 33 185 8e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184766
AA Change: G96D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139204
Gene: ENSMUSG00000021023
AA Change: G96D

DomainStartEndE-ValueType
PDB:4G26|A 153 581 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 A G 3: 60,024,748 H228R probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
Arhgef1 G A 7: 24,916,881 D317N probably damaging Het
Atp11b C A 3: 35,841,043 T910K probably benign Het
Babam1 T A 8: 71,404,355 L320Q probably damaging Het
C530025M09Rik G A 2: 149,831,054 R54C unknown Het
Cilp A T 9: 65,278,212 I530F possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Dgkh A G 14: 78,619,816 V302A probably benign Het
Eps8l3 A G 3: 107,891,288 K497E possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exosc10 A G 4: 148,564,664 D337G probably damaging Het
Fabp3 A T 4: 130,313,988 H94L probably damaging Het
Flrt3 T A 2: 140,659,891 K606* probably null Het
Grm5 A G 7: 87,975,361 T379A probably damaging Het
Hecw1 T A 13: 14,377,747 Y89F probably damaging Het
Hoxd8 T C 2: 74,706,034 S163P probably damaging Het
Itih4 T A 14: 30,892,413 I440N probably damaging Het
Jmjd1c A G 10: 67,249,682 D2236G probably damaging Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Klhl31 G A 9: 77,650,148 E49K probably damaging Het
Mmp10 A G 9: 7,504,115 Y185C probably damaging Het
Mtus2 A T 5: 148,077,846 E483V probably benign Het
Myh7b A G 2: 155,614,199 probably null Het
Olfr1148 C T 2: 87,833,519 P160L possibly damaging Het
Orc3 A T 4: 34,598,645 M187K probably damaging Het
Pcdhb15 A G 18: 37,474,849 N378S probably damaging Het
Pgm2l1 A C 7: 100,261,647 H266P probably damaging Het
Pld5 A T 1: 176,274,698 D59E probably benign Het
Ppp2r2c A G 5: 36,940,106 D212G possibly damaging Het
Rccd1 G A 7: 80,318,909 S301L possibly damaging Het
Shbg T A 11: 69,614,987 D398V probably benign Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tecta G A 9: 42,377,955 T438M possibly damaging Het
Trpm6 A T 19: 18,778,659 I89F probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Ugt2b36 C A 5: 87,066,377 M469I probably damaging Het
Wdr66 G A 5: 123,283,516 R644H possibly damaging Het
Zfp599 A G 9: 22,249,534 V445A possibly damaging Het
Zmym6 T C 4: 127,122,660 C745R probably benign Het
Other mutations in 1110008L16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:1110008L16Rik APN 12 55308875 splice site probably benign
IGL01932:1110008L16Rik APN 12 55304125 missense probably benign
IGL03030:1110008L16Rik APN 12 55304644 missense probably damaging 1.00
R0102:1110008L16Rik UTSW 12 55382297 missense probably benign 0.37
R0892:1110008L16Rik UTSW 12 55382248 splice site probably null
R1479:1110008L16Rik UTSW 12 55379387 missense probably damaging 1.00
R1510:1110008L16Rik UTSW 12 55304212 missense probably benign 0.21
R1845:1110008L16Rik UTSW 12 55304332 missense possibly damaging 0.58
R1992:1110008L16Rik UTSW 12 55338206 missense probably damaging 1.00
R2307:1110008L16Rik UTSW 12 55304316 missense probably damaging 1.00
R4080:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4081:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R4082:1110008L16Rik UTSW 12 55304613 missense possibly damaging 0.88
R5205:1110008L16Rik UTSW 12 55304441 nonsense probably null
R5590:1110008L16Rik UTSW 12 55304472 missense possibly damaging 0.89
R5940:1110008L16Rik UTSW 12 55304874 missense probably damaging 1.00
R5988:1110008L16Rik UTSW 12 55377217 missense probably damaging 1.00
R6147:1110008L16Rik UTSW 12 55379308 missense probably damaging 0.99
R7208:1110008L16Rik UTSW 12 55308645 splice site probably null
R7220:1110008L16Rik UTSW 12 55304415 missense possibly damaging 0.79
R7304:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7316:1110008L16Rik UTSW 12 55304644 missense probably damaging 1.00
R7502:1110008L16Rik UTSW 12 55304421 missense probably damaging 1.00
R7908:1110008L16Rik UTSW 12 55379465 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- AACCCTTACTTTGAGCTAGGCC -3'
(R):5'- CTGAACAACAGTTGCGTGCC -3'

Sequencing Primer
(F):5'- TACTTTGAGCTAGGCCCTGCG -3'
(R):5'- ACAACAGTTGCGTGCCATCTG -3'
Posted On2020-09-15