Incidental Mutation 'R7968:Ppef2'
ID 650455
Institutional Source Beutler Lab
Gene Symbol Ppef2
Ensembl Gene ENSMUSG00000029410
Gene Name protein phosphatase, EF hand calcium-binding domain 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7968 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92226679-92256278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92249163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 118 (R118C)
Ref Sequence ENSEMBL: ENSMUSP00000031359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031359] [ENSMUST00000201130]
AlphaFold O35385
Predicted Effect probably damaging
Transcript: ENSMUST00000031359
AA Change: R118C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031359
Gene: ENSMUSG00000029410
AA Change: R118C

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201130
AA Change: R118C

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144157
Gene: ENSMUSG00000029410
AA Change: R118C

DomainStartEndE-ValueType
IQ 18 40 3.48e-1 SMART
PP2Ac 141 544 1.97e-118 SMART
EFh 576 604 3.25e1 SMART
EFh 660 688 5.44e-3 SMART
EFh 700 728 1.67e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein phosphatase with EF-hand motif family. The protein contains a protein phosphatase catalytic domain, and at least two EF-hand calcium-binding motifs in its C terminus. Although its substrate(s) is unknown, the encoded protein, which is expressed specifically in photoreceptors and the pineal, has been suggested to play a role in the visual system. This gene shares high sequence similarity with the Drosophila retinal degeneration C (rdgC) gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation appear to be phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,460 T35A Het
Adamts16 A C 13: 70,738,582 S1030A probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aff4 C T 11: 53,409,348 T1026I probably damaging Het
Arfgef1 T C 1: 10,172,920 Y1065C probably damaging Het
Arhgef3 G T 14: 27,386,113 D192Y probably damaging Het
Arhgef3 G A 14: 27,394,105 R268Q probably damaging Het
Atp6v0e T A 17: 26,694,911 probably null Het
Cenpc1 A G 5: 86,033,692 Y605H probably benign Het
Cftr T C 6: 18,226,049 V332A probably benign Het
Csmd2 A G 4: 128,197,325 H219R Het
Csnk1g3 C T 18: 53,895,654 probably benign Het
Cyp4f17 T C 17: 32,524,142 V263A possibly damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam189a2 G T 19: 23,984,727 T304K probably damaging Het
Gm34653 A G 2: 34,838,245 N19D probably damaging Het
Gstm4 A T 3: 108,044,361 M35K probably damaging Het
Kcna2 A G 3: 107,105,144 Y347C possibly damaging Het
Kcnh7 G A 2: 62,736,100 T829M probably damaging Het
Kcnu1 T C 8: 25,910,870 V682A probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kera A G 10: 97,608,959 E60G possibly damaging Het
Letm2 C T 8: 25,593,750 G155D probably damaging Het
Lrfn4 G A 19: 4,613,315 A397V probably benign Het
Lrp4 A G 2: 91,494,079 Q1253R possibly damaging Het
Mob1a T A 6: 83,338,305 M145K probably benign Het
Nab1 A G 1: 52,490,136 C201R probably damaging Het
Nlrp9b A G 7: 20,028,568 E710G probably benign Het
Oas2 A G 5: 120,738,372 V502A probably benign Het
Olfr385 T C 11: 73,589,328 S137G probably benign Het
Olfr652 A T 7: 104,564,650 H143L probably benign Het
Olfr653 T A 7: 104,580,388 C247* probably null Het
Parg A T 14: 32,214,370 H494L possibly damaging Het
Phf20 T A 2: 156,293,544 D600E probably benign Het
Ptprz1 T A 6: 22,959,676 N57K probably damaging Het
Rrbp1 A T 2: 143,990,161 S29T probably damaging Het
Sema3g C A 14: 31,220,648 R69S probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc4a3 A G 1: 75,551,363 T419A probably benign Het
Smc3 T C 19: 53,623,218 probably null Het
Sntg1 C T 1: 8,465,536 W288* probably null Het
Synpo2l G T 14: 20,666,802 probably null Het
Tap1 A G 17: 34,194,912 I634V probably damaging Het
Tmem25 A G 9: 44,795,686 S278P probably benign Het
Togaram2 T C 17: 71,717,433 S871P probably benign Het
Trim37 T C 11: 87,149,353 V225A possibly damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Ppef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ppef2 APN 5 92234237 missense probably damaging 1.00
IGL01105:Ppef2 APN 5 92249196 missense possibly damaging 0.91
IGL01613:Ppef2 APN 5 92235820 missense probably benign 0.01
IGL01793:Ppef2 APN 5 92246756 missense probably damaging 1.00
IGL02529:Ppef2 APN 5 92244737 missense probably damaging 1.00
IGL02702:Ppef2 APN 5 92231819 missense probably benign 0.01
IGL02992:Ppef2 APN 5 92235900 nonsense probably null
IGL02995:Ppef2 APN 5 92235900 nonsense probably null
IGL02996:Ppef2 APN 5 92235900 nonsense probably null
IGL03169:Ppef2 APN 5 92235900 nonsense probably null
IGL02991:Ppef2 UTSW 5 92235900 nonsense probably null
R0494:Ppef2 UTSW 5 92253093 splice site probably benign
R0659:Ppef2 UTSW 5 92230509 missense probably damaging 1.00
R0781:Ppef2 UTSW 5 92244830 missense probably benign 0.39
R1162:Ppef2 UTSW 5 92253121 missense probably benign 0.00
R1870:Ppef2 UTSW 5 92250512 missense probably damaging 1.00
R2212:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R2973:Ppef2 UTSW 5 92239094 missense probably benign
R3412:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3413:Ppef2 UTSW 5 92228722 missense probably damaging 0.97
R3745:Ppef2 UTSW 5 92239151 splice site probably benign
R4878:Ppef2 UTSW 5 92228740 splice site probably null
R5027:Ppef2 UTSW 5 92234291 missense probably damaging 1.00
R5156:Ppef2 UTSW 5 92244602 critical splice donor site probably null
R5316:Ppef2 UTSW 5 92235811 missense probably benign 0.00
R5590:Ppef2 UTSW 5 92239139 missense probably damaging 0.99
R5773:Ppef2 UTSW 5 92250561 missense probably damaging 1.00
R5881:Ppef2 UTSW 5 92250529 nonsense probably null
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6032:Ppef2 UTSW 5 92230524 missense probably benign 0.23
R6182:Ppef2 UTSW 5 92227066 missense probably damaging 1.00
R6335:Ppef2 UTSW 5 92235754 missense probably damaging 1.00
R6645:Ppef2 UTSW 5 92230461 missense probably benign 0.02
R7448:Ppef2 UTSW 5 92228704 missense probably damaging 1.00
R7576:Ppef2 UTSW 5 92253134 missense possibly damaging 0.87
R7988:Ppef2 UTSW 5 92238982 missense probably benign 0.00
R8200:Ppef2 UTSW 5 92245392 missense probably benign 0.13
R8212:Ppef2 UTSW 5 92228665 missense possibly damaging 0.87
R9687:Ppef2 UTSW 5 92238887 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGCTACCTGCAGGCTGAAC -3'
(R):5'- AGCATTGACGGTCCCTCAAG -3'

Sequencing Primer
(F):5'- AAGGTTCCGCTCTTAGAAGC -3'
(R):5'- GTCCCTCAAGGTTGGTTCCTAAG -3'
Posted On 2020-09-15