Incidental Mutation 'R7968:Aff4'
ID 650470
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7968 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 53350833-53421830 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 53409348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1026 (T1026I)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: T1026I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: T1026I

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,460 T35A Het
Adamts16 A C 13: 70,738,582 S1030A probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Arfgef1 T C 1: 10,172,920 Y1065C probably damaging Het
Arhgef3 G T 14: 27,386,113 D192Y probably damaging Het
Arhgef3 G A 14: 27,394,105 R268Q probably damaging Het
Atp6v0e T A 17: 26,694,911 probably null Het
Cenpc1 A G 5: 86,033,692 Y605H probably benign Het
Cftr T C 6: 18,226,049 V332A probably benign Het
Csmd2 A G 4: 128,197,325 H219R Het
Csnk1g3 C T 18: 53,895,654 probably benign Het
Cyp4f17 T C 17: 32,524,142 V263A possibly damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Fam189a2 G T 19: 23,984,727 T304K probably damaging Het
Gm34653 A G 2: 34,838,245 N19D probably damaging Het
Gstm4 A T 3: 108,044,361 M35K probably damaging Het
Kcna2 A G 3: 107,105,144 Y347C possibly damaging Het
Kcnh7 G A 2: 62,736,100 T829M probably damaging Het
Kcnu1 T C 8: 25,910,870 V682A probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kera A G 10: 97,608,959 E60G possibly damaging Het
Letm2 C T 8: 25,593,750 G155D probably damaging Het
Lrfn4 G A 19: 4,613,315 A397V probably benign Het
Lrp4 A G 2: 91,494,079 Q1253R possibly damaging Het
Mob1a T A 6: 83,338,305 M145K probably benign Het
Nab1 A G 1: 52,490,136 C201R probably damaging Het
Nlrp9b A G 7: 20,028,568 E710G probably benign Het
Oas2 A G 5: 120,738,372 V502A probably benign Het
Olfr385 T C 11: 73,589,328 S137G probably benign Het
Olfr652 A T 7: 104,564,650 H143L probably benign Het
Olfr653 T A 7: 104,580,388 C247* probably null Het
Parg A T 14: 32,214,370 H494L possibly damaging Het
Phf20 T A 2: 156,293,544 D600E probably benign Het
Ppef2 G A 5: 92,249,163 R118C probably damaging Het
Ptprz1 T A 6: 22,959,676 N57K probably damaging Het
Rrbp1 A T 2: 143,990,161 S29T probably damaging Het
Sema3g C A 14: 31,220,648 R69S probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc4a3 A G 1: 75,551,363 T419A probably benign Het
Smc3 T C 19: 53,623,218 probably null Het
Sntg1 C T 1: 8,465,536 W288* probably null Het
Synpo2l G T 14: 20,666,802 probably null Het
Tap1 A G 17: 34,194,912 I634V probably damaging Het
Tmem25 A G 9: 44,795,686 S278P probably benign Het
Togaram2 T C 17: 71,717,433 S871P probably benign Het
Trim37 T C 11: 87,149,353 V225A possibly damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6576:Aff4 UTSW 11 53400441 missense probably damaging 1.00
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
R7848:Aff4 UTSW 11 53404512 missense probably benign 0.05
R8159:Aff4 UTSW 11 53411894 missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53398257 missense probably damaging 0.98
R8241:Aff4 UTSW 11 53400171 missense probably benign 0.00
R8284:Aff4 UTSW 11 53404552 missense probably damaging 0.99
R8373:Aff4 UTSW 11 53400267 nonsense probably null
R8695:Aff4 UTSW 11 53368682 missense probably damaging 1.00
R8777:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53399956 missense probably damaging 1.00
R8780:Aff4 UTSW 11 53380617 missense probably damaging 1.00
R8798:Aff4 UTSW 11 53400508 critical splice donor site probably benign
R8838:Aff4 UTSW 11 53406638 missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53372404 missense probably benign
R9146:Aff4 UTSW 11 53408136 missense probably benign 0.06
R9329:Aff4 UTSW 11 53397859 missense probably damaging 1.00
R9378:Aff4 UTSW 11 53372479 missense probably damaging 0.98
R9471:Aff4 UTSW 11 53380646 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTGAGAGGTAACATTGACCCTG -3'
(R):5'- AATCCAATATCCGTACTTGAAGGC -3'

Sequencing Primer
(F):5'- TAACATTGACCCTGGGCCATG -3'
(R):5'- CGTACTTGAAGGCTTTCCCAAG -3'
Posted On 2020-09-15