Incidental Mutation 'R7968:Fam189a2'
ID650487
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7968 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23984727 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 304 (T304K)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably damaging
Transcript: ENSMUST00000096164
AA Change: T304K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: T304K

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,945,460 T35A Het
Adamts16 A C 13: 70,738,582 S1030A probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aff4 C T 11: 53,409,348 T1026I probably damaging Het
Arfgef1 T C 1: 10,172,920 Y1065C probably damaging Het
Arhgef3 G T 14: 27,386,113 D192Y probably damaging Het
Arhgef3 G A 14: 27,394,105 R268Q probably damaging Het
Cenpc1 A G 5: 86,033,692 Y605H probably benign Het
Cftr T C 6: 18,226,049 V332A probably benign Het
Csmd2 A G 4: 128,197,325 H219R Het
Csnk1g3 C T 18: 53,895,654 probably benign Het
Cyp4f17 T C 17: 32,524,142 V263A possibly damaging Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gm34653 A G 2: 34,838,245 N19D probably damaging Het
Gstm4 A T 3: 108,044,361 M35K probably damaging Het
Kcna2 A G 3: 107,105,144 Y347C possibly damaging Het
Kcnh7 G A 2: 62,736,100 T829M probably damaging Het
Kcnu1 T C 8: 25,910,870 V682A probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Kera A G 10: 97,608,959 E60G possibly damaging Het
Letm2 C T 8: 25,593,750 G155D probably damaging Het
Lrfn4 G A 19: 4,613,315 A397V probably benign Het
Lrp4 A G 2: 91,494,079 Q1253R possibly damaging Het
Mob1a T A 6: 83,338,305 M145K probably benign Het
Nab1 A G 1: 52,490,136 C201R probably damaging Het
Nlrp9b A G 7: 20,028,568 E710G probably benign Het
Oas2 A G 5: 120,738,372 V502A probably benign Het
Olfr385 T C 11: 73,589,328 S137G probably benign Het
Olfr652 A T 7: 104,564,650 H143L probably benign Het
Olfr653 T A 7: 104,580,388 C247* probably null Het
Parg A T 14: 32,214,370 H494L possibly damaging Het
Phf20 T A 2: 156,293,544 D600E probably benign Het
Ppef2 G A 5: 92,249,163 R118C probably damaging Het
Ptprz1 T A 6: 22,959,676 N57K probably damaging Het
Rrbp1 A T 2: 143,990,161 S29T probably damaging Het
Sema3g C A 14: 31,220,648 R69S probably damaging Het
Slc12a4 G A 8: 105,951,605 R319W possibly damaging Het
Slc4a3 A G 1: 75,551,363 T419A probably benign Het
Smc3 T C 19: 53,623,218 probably null Het
Sntg1 C T 1: 8,465,536 W288* probably null Het
Tap1 A G 17: 34,194,912 I634V probably damaging Het
Tmem25 A G 9: 44,795,686 S278P probably benign Het
Togaram2 T C 17: 71,717,433 S871P probably benign Het
Trim37 T C 11: 87,149,353 V225A possibly damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGGTGTCAGTTTTCCCTAG -3'
(R):5'- AAGCACTGTGTGGCATTTCC -3'

Sequencing Primer
(F):5'- CTCTAGGTCAAGATTGGGACTTATC -3'
(R):5'- GGCATTTCCACCTAGCTTTCCATC -3'
Posted On2020-09-15